Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection

Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer

Investigation of chemical constituents of Eranthis longistipitata (Ranunculaceae): coumarins and furochromones

Aqueous‐ethanol extracts (70%) from the leaves of Eranthis longistipitata Regel. (Ranunculaceae Juss.)—collected from natural populations of Kyrgyzstan—were studied by liquid chromatography with high‐resolution mass spectrometry (LC‐HRMS). There was no variation of the metabolic profiles among plants that were collected from different populations. More than 160 compounds were found in the leaves, of which 72 were identified to the class level and 58 to the individual‐ compound level. The class of flavonoids proved to be the most widely represented (19 compounds), including six aglycones [quercetin, kaempferol, aromadendrin, 6‐methoxytaxifolin, phloretin, and (+)‐catechin] and mono‐ and diglycosides (the other 13 compounds). In the analyzed samples of E. longistipitata, 14 fatty acid–related compounds were identified, but coumarins and furochromones that were found in E. longistipitata were the most interesting result; furochromones khelloside, khellin, visnagin, and cimifugin were found in E. longistipitata for the first time. Coumarins 5,7‐dihydroxy‐4‐methylcoumarin, scoparone, fraxetin, and luvangetin and furochromones methoxsalen, 5‐O‐methylvisammioside, and visamminol‐3′‐O‐glucoside were detected for the first time in the genus Eranthis Salisb. For all the above compounds, the structural formulas are given. Furthermore, detailed information (with structural formulas) is provided on the diversity of chromones and furochromones in other representatives of Eranthis. The presence of chromones in plants of the genus Eranthis confirms its closeness to the genus Actaea L. because chromones are synthesized by normal physiological processes only in these members of the Ranunculaceae family

Design of a Gd-DOTA-Phthalocyanine Conjugate Combining MRI Contrast Imaging and Photosensitization Properties as a Potential Molecular Theranostic

Cataloged from PDF version of article.The design and synthesis of a phthalocyanine - Gd-DOTA conjugate is presented to open the way to novel molecular theranostics, combining the properties of MRI contrast imaging with photodynamic therapy. The rational design of the conjugate integrates isomeric purity of the phthalocyanine core substitution, suitable biocompatibility with the use of polyoxo water-solubilizing substituents, and a convergent synthetic strategy ended by the use of click chemistry to graft the Gd-DOTA moiety to the phthalocyanine. Photophysical and photochemical properties, contrast imaging experiments and preliminary in vitro investigations proved that such a combination is relevant and lead to a new type of potential theranostic agent

Application of Parallel Reaction Monitoring to the Development and Validation of a Quantitative Assay for ST-246 in Human Plasma

In this work, we developed and validated a robust and sensitive method of liquid chromatography with high-resolution mass spectrometry in parallel reaction monitoring (PRM) mode for ST-246 (tecovirimat) quantification in human blood plasma. The method was compared with the multiple reaction monitoring (MRM) technique and showed better selectivity and similar sensitivity in a wider concentration range (10–5000 ng/mL). Within this range, intra- and interday variability of precision and accuracy were within acceptable ranges in accordance with the European Medicines Agency guidelines, and recovery was 87.9–100.6%. Samples were stable at 4 °C within 48 h and at −20 °C up to 3 months. The recovery and matrix effects in the proposed HRMS method were about 5% higher than those reported for the MRM method, but the PRM method showed better accuracy with comparable precision. It was found that the ST-246 concentration shown by the PRM method is approximately 24% higher than the output of the MRM one. Nonetheless, the high selectivity with similar sensitivity, as compared with traditional MRM methods, makes the proposed approach attractive for research and clinical use

Parallel Reaction Monitoring Mode for Atenolol Quantification in Dried Plasma Spots by Liquid Chromatography Coupled with High-Resolution Mass Spectrometry

In this study, we reported a rapid, sensitive, robust, and validated method for atenolol quantification in dried plasma spots (DPS) by liquid chromatography with high-resolution mass spectrometry (LC-HRMS) using parallel reaction monitoring mode (PRM). Aliquots of 25 µL human plasma were placed onto Whatman 903 Cards and air-dried. Disks (3.2 mm internal diameter) were punched, and a 100 µL working internal standard solution was added to each sample and then incubated on a shaker for 15 min at 40 °C, followed by rapid centrifugation (10,000× g, 10 s). The supernatant was transferred into 300 µL vials for subsequent LC–HRMS analysis. After chromatographic separation, atenolol and the internal standard were quantified in positive-ion parallel reaction monitoring mode by detection of all target product ions at 10 ppm tolerances. The total time of the analysis was 5 min. The calibration curve was linear in the range of 5–1000 ng/mL with interday and intraday precision levels and biases of <14.4%, and recovery was 62.9–81.0%. The atenolol in DPS was stable for ≥30 days at 25 and 4 °C. This fully validated method is selective and suitable for atenolol quantitation in DPS using LC–HRMS