715 research outputs found
Magnetic field dependence of galfenol elastic properties
Elastic shear moduli measurements on Fe100−xGax (x = 12–33) single crystals (via resonant ultrasound spectroscopy) with and without a magnetic field and within 4–300 K are reported. The pronounced softening of the tetragonal shear modulus c′ is concluded to be, based on magnetoelastic coupling, the cause of the second peak in the tetragonal magnetostriction constant λ100 near x = 28. Exceedingly high ΔE effects ( ∼ 25%), combined with the extreme softness in c′ (c′\u3c10 GPa), suggest structural changes take place, yet, gradual in nature, as the moduli show a smooth dependence on Ga concentration, temperature, and magnetic field. Shear anisotropy (c44/c′) as high as 14.7 was observed for Fe71.2Ga28.8
Influence of intermartensitic transitions on transport properties of Ni2.16Mn0.84Ga alloy
Magnetic, transport, and x-ray diffraction measurements of ferromagnetic
shape memory alloy NiMnGa revealed that this alloy undergoes
an intermartensitic transition upon cooling, whereas no such a transition is
observed upon subsequent heating. The difference in the modulation of the
martensite forming upon cooling from the high-temperature austenitic state
[5-layered (5M) martensite], and the martensite forming upon the
intermartensitic transition [7-layered (7M) martensite] strongly affects the
magnetic and transport properties of the alloy and results in a large thermal
hysteresis of the resistivity and magnetization . The
intermartensitic transition has an especially marked influence on the transport
properties, as is evident from a large difference in the resistivity of the 5M
and 7M martensite, , which is larger than the jump of resistivity at
the martensitic transition from the cubic austenitic phase to the monoclinic 5M
martensitic phase. We assume that this significant difference in between
the martensitic phases is accounted for by nesting features of the Fermi
surface. It is also suggested that the nesting hypothesis can explain the
uncommon behavior of the resistivity at the martensitic transition, observed in
stoichiometric and near-stoichiometric Ni-Mn-Ga alloys.Comment: 7 pages, 6 figures, REVTEX
PROSPECTS AND RESULTS OF STUDYING THE COLLECTION OF CHICKPEA FROM VIR AT OMSK STATE AGRARIAN UNIVERSITY
In 2012-1016, 23 chickpea accessions from VIR and 23 accessions from the collection of chickpea somaclones of the Siberian Research Institute of Forages were studied at Omsk State Agrarian University. The research performed in the southern forest-steppe of West Siberia resulted in identifying chickpea accessions with a shorter growing season, high plant productivity, good processability, and high symbiotic activity. The possibility of using cluster analysis for comprehensive assessment of source material for chickpea breeding was demonstrated. The nature of inheritance of agronomic traits in F1 chickpea hybrids was revealed, and recommendations for selection were formulated. A correlation was established between the major characters
Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer
Mechanisms of Manganese-Assisted Nonradiative Recombination in Cd(Mn)Se/Zn(Mn)Se Quantum Dots
Mechanisms of nonradiative recombination of electron-hole complexes in
Cd(Mn)Se/Zn(Mn)Se quantum dots accompanied by interconfigurational excitations
of Mn ions are analyzed within the framework of single electron model of
deep {\it 3d}-levels in semiconductors. In addition to the mechanisms caused by
Coulomb and exchange interactions, which are related because of the Pauli
principle, another mechanism due to {\it sp-d} mixing is considered. It is
shown that the Coulomb mechanism reduces to long-range dipole-dipole energy
transfer from photoexcited quantum dots to Mn ions. The recombination
due to the Coulomb mechanism is allowed for any states of Mn ions and
{\it e-h} complexes. In contrast, short-range exchange and
recombinations are subject to spin selection rules, which are the result of
strong {\it lh-hh} splitting of hole states in quantum dots. Estimates show
that efficiency of the {\it sp-d} mechanism can considerably exceed that of the
Coulomb mechanism. The phonon-assisted recombination and processes involving
upper excited states of Mn ions are studied. The increase in PL
intensity of an ensemble of quantum dots in a magnetic field perpendicular to
the sample growth plane observed earlier is analyzed as a possible
manifestation of the spin-dependent recombination.Comment: 14 pages, 2 figure
ОСОБЛИВОСТІ ВИКЛАДАННЯ ХІМІЧНИХ ДИСЦИПЛІН ІНОЗЕМНИМ СТУДЕНТАМ В МЕДИЧНОМУ ВИЩОМУ НАВЧАЛЬНОМУ ЗАКЛАДІ
The article discusses the features of the educational process of chemical disciplines learning by foreign students. During the process of teching methods developing, such as teaching material in class; workshops; control of knowledge, it is necessary to take into account the characteristics of school education in countries from which the students come. It has been proved in practice that the development of quality guidelines, reference summaries, charts and tables that summarize the material, help foreign students with significant language problems to learn difficult material on themedical and bioorganic chemistry courses.У статті розглядаються особливості організації навчально процесу з викладання хімічних дисциплін іноземним студентам. Показана необхідність урахування особливостей шкільної освіти у країнах, з яких приїхали студенти, при розробці методів: викладання матеріалу на лекціях; проведення практичних занять; контролю знань. Доведено на практиці, що розробка якісних методичних вказівок, опорних конспектів, схем та таблиць, що узагальнюють матеріал, сприяють кращому засвоєнню складного та об’ємного матеріалу з курсів медичної та біоорганічної хімії іноземними студентами, що мають значні мовні проблеми
Gamma Ray Bursts from the Evolved Galactic Nuclei
A new cosmological scenario for the origin of gamma ray bursts (GRBs) is
proposed. In our scenario, a highly evolved central core in the dense galactic
nucleus is formed containing a subsystem of compact stellar remnants (CSRs),
such as neutron stars and black holes. Those subsystems result from the
dynamical evolution of dense central stellar clusters in the galactic nuclei
through merging of stars, thereby forming (as has been realized by many
authors) the short-living massive stars and then CSRs. We estimate the rate of
random CSR collisions in the evolved galactic nuclei by taking into account,
similar to Quinlan & Shapiro (1987), the dissipative encounters of CSRs, mainly
due to radiative losses of gravitational waves, which results in the formation
of intermediate short-living binaries, with further coalescence of the
companions to produce GRBs. We also consider how the possible presence of a
central supermassive black hole, formed in a highly evolved galactic nucleus,
influences the CSR binary formation. This scenario does not postulate ad hoc a
required number of tight binary neutron stars in the galaxies. Instead, it
gives, for the most realistic parameters of the evolved nuclei, the expected
rate of GRBs consistent with the observed one, thereby explaining the GRB
appearance in a natural way of the dynamical evolution of galactic nuclei. In
addition, this scenario provides an opportunity for a cosmological GRB
recurrence, previously considered to be a distinctive feature of GRBs of a
local origin only. We also discuss some other observational tests of the
proposed scenario.Comment: 25 pages, LATEX, uses aasms4.sty, accepted by Ap
Coexistence of ferro- and antiferromagnetic order in Mn-doped NiMnGa
Ni-Mn-Ga is interesting as a prototype of a magnetic shape-memory alloy
showing large magnetic field induced strains. We present here results for the
magnetic ordering of Mn-rich Ni-Mn-Ga alloys based on both experiments and
theory. Experimental trends for the composition dependence of the magnetization
are measured by a vibrating sample magnetometer (VSM) in magnetic fields of up
to several tesla and at low temperatures. The saturation magnetization has a
maximum near the stoichiometric composition and it decreases with increasing Mn
content. This unexpected behaviour is interpreted via first-principles
calculations within the density-functional theory. We show that extra Mn atoms
are antiferromagnetically aligned to the other moments, which explains the
dependence of the magnetization on composition. In addition, the effect of Mn
doping on the stabilization of the structural phases and on the magnetic
anisotropy energy is demonstrated.Comment: 4 pages, 3 figure
Resonant Cyclotron Radiation Transfer Model Fits to Spectra from Gamma-Ray Burst GRB870303
We demonstrate that models of resonant cyclotron radiation transfer in a
strong field (i.e. cyclotron scattering) can account for spectral lines seen at
two epochs, denoted S1 and S2, in the Ginga data for GRB870303. Using a
generalized version of the Monte Carlo code of Wang et al. (1988,1989b), we
model line formation by injecting continuum photons into a static
plane-parallel slab of electrons threaded by a strong neutron star magnetic
field (~ 10^12 G) which may be oriented at an arbitrary angle relative to the
slab normal. We examine two source geometries, which we denote "1-0" and "1-1,"
with the numbers representing the relative electron column densities above and
below the continuum photon source plane. We compare azimuthally symmetric
models, i.e. models in which the magnetic field is parallel to the slab normal,
with models having more general magnetic field orientations. If the bursting
source has a simple dipole field, these two model classes represent line
formation at the magnetic pole, or elsewhere on the stellar surface. We find
that the data of S1 and S2, considered individually, are consistent with both
geometries, and with all magnetic field orientations, with the exception that
the S1 data clearly favor line formation away from a polar cap in the 1-1
geometry, with the best-fit model placing the line-forming region at the
magnetic equator. Within both geometries, fits to the combined (S1+S2) data
marginally favor models which feature equatorial line formation, and in which
the observer's orientation with respect to the slab changes between the two
epochs. We interpret this change as being due to neutron star rotation, and we
place limits on the rotation period.Comment: LaTeX2e (aastex.cls included); 45 pages text, 17 figures (on 21
pages); accepted by ApJ (to be published 1 Nov 1999, v. 525
Diffuse-Charge Dynamics in Electrochemical Systems
The response of a model micro-electrochemical system to a time-dependent
applied voltage is analyzed. The article begins with a fresh historical review
including electrochemistry, colloidal science, and microfluidics. The model
problem consists of a symmetric binary electrolyte between parallel-plate,
blocking electrodes which suddenly apply a voltage. Compact Stern layers on the
electrodes are also taken into account. The Nernst-Planck-Poisson equations are
first linearized and solved by Laplace transforms for small voltages, and
numerical solutions are obtained for large voltages. The ``weakly nonlinear''
limit of thin double layers is then analyzed by matched asymptotic expansions
in the small parameter , where is the
screening length and the electrode separation. At leading order, the system
initially behaves like an RC circuit with a response time of
(not ), where is the ionic diffusivity, but nonlinearity
violates this common picture and introduce multiple time scales. The charging
process slows down, and neutral-salt adsorption by the diffuse part of the
double layer couples to bulk diffusion at the time scale, . In the
``strongly nonlinear'' regime (controlled by a dimensionless parameter
resembling the Dukhin number), this effect produces bulk concentration
gradients, and, at very large voltages, transient space charge. The article
concludes with an overview of more general situations involving surface
conduction, multi-component electrolytes, and Faradaic processes.Comment: 10 figs, 26 pages (double-column), 141 reference
- …