Magnetic field dependence of galfenol elastic properties

Elastic shear moduli measurements on Fe100−xGax (x = 12–33) single crystals (via resonant ultrasound spectroscopy) with and without a magnetic field and within 4–300 K are reported. The pronounced softening of the tetragonal shear modulus c′ is concluded to be, based on magnetoelastic coupling, the cause of the second peak in the tetragonal magnetostriction constant λ100 near x = 28. Exceedingly high ΔE effects ( ∼ 25%), combined with the extreme softness in c′ (c′\u3c10 GPa), suggest structural changes take place, yet, gradual in nature, as the moduli show a smooth dependence on Ga concentration, temperature, and magnetic field. Shear anisotropy (c44/c′) as high as 14.7 was observed for Fe71.2Ga28.8

Influence of intermartensitic transitions on transport properties of Ni2.16Mn0.84Ga alloy

Magnetic, transport, and x-ray diffraction measurements of ferromagnetic shape memory alloy Ni$_{2.16}$Mn$_{0.84}$Ga revealed that this alloy undergoes an intermartensitic transition upon cooling, whereas no such a transition is observed upon subsequent heating. The difference in the modulation of the martensite forming upon cooling from the high-temperature austenitic state [5-layered (5M) martensite], and the martensite forming upon the intermartensitic transition [7-layered (7M) martensite] strongly affects the magnetic and transport properties of the alloy and results in a large thermal hysteresis of the resistivity $\rho$ and magnetization $M$. The intermartensitic transition has an especially marked influence on the transport properties, as is evident from a large difference in the resistivity of the 5M and 7M martensite, $(\rho_{\mathrm{5M}} - \rho_{\mathrm{7M}})/\rho _{\mathrm{5M}} \approx 15$, which is larger than the jump of resistivity at the martensitic transition from the cubic austenitic phase to the monoclinic 5M martensitic phase. We assume that this significant difference in $\rho$ between the martensitic phases is accounted for by nesting features of the Fermi surface. It is also suggested that the nesting hypothesis can explain the uncommon behavior of the resistivity at the martensitic transition, observed in stoichiometric and near-stoichiometric Ni-Mn-Ga alloys.Comment: 7 pages, 6 figures, REVTEX

PROSPECTS AND RESULTS OF STUDYING THE COLLECTION OF CHICKPEA FROM VIR AT OMSK STATE AGRARIAN UNIVERSITY

In 2012-1016, 23 chickpea accessions from VIR and 23 accessions from the collection of chickpea somaclones of the Siberian Research Institute of Forages were studied at Omsk State Agrarian University. The research performed in the southern forest-steppe of West Siberia resulted in identifying chickpea accessions with a shorter growing season, high plant productivity, good processability, and high symbiotic activity. The possibility of using cluster analysis for comprehensive assessment of source material for chickpea breeding was demonstrated. The nature of inheritance of agronomic traits in F1 chickpea hybrids was revealed, and recommendations for selection were formulated. A correlation was established between the major characters

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer

Mechanisms of Manganese-Assisted Nonradiative Recombination in Cd(Mn)Se/Zn(Mn)Se Quantum Dots

Mechanisms of nonradiative recombination of electron-hole complexes in Cd(Mn)Se/Zn(Mn)Se quantum dots accompanied by interconfigurational excitations of Mn$^{2+}$ ions are analyzed within the framework of single electron model of deep {\it 3d}-levels in semiconductors. In addition to the mechanisms caused by Coulomb and exchange interactions, which are related because of the Pauli principle, another mechanism due to {\it sp-d} mixing is considered. It is shown that the Coulomb mechanism reduces to long-range dipole-dipole energy transfer from photoexcited quantum dots to Mn$^{2+}$ ions. The recombination due to the Coulomb mechanism is allowed for any states of Mn$^{2+}$ ions and {\it e-h} complexes. In contrast, short-range exchange and ${\it sp-d}$ recombinations are subject to spin selection rules, which are the result of strong {\it lh-hh} splitting of hole states in quantum dots. Estimates show that efficiency of the {\it sp-d} mechanism can considerably exceed that of the Coulomb mechanism. The phonon-assisted recombination and processes involving upper excited states of Mn$^{2+}$ ions are studied. The increase in PL intensity of an ensemble of quantum dots in a magnetic field perpendicular to the sample growth plane observed earlier is analyzed as a possible manifestation of the spin-dependent recombination.Comment: 14 pages, 2 figure

ОСОБЛИВОСТІ ВИКЛАДАННЯ ХІМІЧНИХ ДИСЦИПЛІН ІНОЗЕМНИМ СТУДЕНТАМ В МЕДИЧНОМУ ВИЩОМУ НАВЧАЛЬНОМУ ЗАКЛАДІ

The article discusses the features of the educational process of chemical disciplines learning by foreign students. During the process of teching methods developing, such as teaching material in class; workshops; control of knowledge, it is necessary to take into account the characteristics of school education in countries from which the students come. It has been proved in practice that the development of quality guidelines, reference summaries, charts and tables that summarize the material, help foreign students with significant language problems to learn difficult material on themedical and bioorganic chemistry courses.У статті розглядаються особливості організації навчально процесу з викладання хімічних дисциплін іноземним студентам. Показана необхідність урахування особливостей шкільної освіти у країнах, з яких приїхали студенти, при розробці методів: викладання матеріалу на лекціях; проведення практичних занять; контролю знань. Доведено на практиці, що розробка якісних методичних вказівок, опорних конспектів, схем та таблиць, що узагальнюють матеріал, сприяють кращому засвоєнню складного та об’ємного матеріалу з курсів медичної та біоорганічної хімії іноземними студентами, що мають значні мовні проблеми

Gamma Ray Bursts from the Evolved Galactic Nuclei

A new cosmological scenario for the origin of gamma ray bursts (GRBs) is proposed. In our scenario, a highly evolved central core in the dense galactic nucleus is formed containing a subsystem of compact stellar remnants (CSRs), such as neutron stars and black holes. Those subsystems result from the dynamical evolution of dense central stellar clusters in the galactic nuclei through merging of stars, thereby forming (as has been realized by many authors) the short-living massive stars and then CSRs. We estimate the rate of random CSR collisions in the evolved galactic nuclei by taking into account, similar to Quinlan & Shapiro (1987), the dissipative encounters of CSRs, mainly due to radiative losses of gravitational waves, which results in the formation of intermediate short-living binaries, with further coalescence of the companions to produce GRBs. We also consider how the possible presence of a central supermassive black hole, formed in a highly evolved galactic nucleus, influences the CSR binary formation. This scenario does not postulate ad hoc a required number of tight binary neutron stars in the galaxies. Instead, it gives, for the most realistic parameters of the evolved nuclei, the expected rate of GRBs consistent with the observed one, thereby explaining the GRB appearance in a natural way of the dynamical evolution of galactic nuclei. In addition, this scenario provides an opportunity for a cosmological GRB recurrence, previously considered to be a distinctive feature of GRBs of a local origin only. We also discuss some other observational tests of the proposed scenario.Comment: 25 pages, LATEX, uses aasms4.sty, accepted by Ap

Coexistence of ferro- and antiferromagnetic order in Mn-doped Ni2_2MnGa

Ni-Mn-Ga is interesting as a prototype of a magnetic shape-memory alloy showing large magnetic field induced strains. We present here results for the magnetic ordering of Mn-rich Ni-Mn-Ga alloys based on both experiments and theory. Experimental trends for the composition dependence of the magnetization are measured by a vibrating sample magnetometer (VSM) in magnetic fields of up to several tesla and at low temperatures. The saturation magnetization has a maximum near the stoichiometric composition and it decreases with increasing Mn content. This unexpected behaviour is interpreted via first-principles calculations within the density-functional theory. We show that extra Mn atoms are antiferromagnetically aligned to the other moments, which explains the dependence of the magnetization on composition. In addition, the effect of Mn doping on the stabilization of the structural phases and on the magnetic anisotropy energy is demonstrated.Comment: 4 pages, 3 figure

Resonant Cyclotron Radiation Transfer Model Fits to Spectra from Gamma-Ray Burst GRB870303

We demonstrate that models of resonant cyclotron radiation transfer in a strong field (i.e. cyclotron scattering) can account for spectral lines seen at two epochs, denoted S1 and S2, in the Ginga data for GRB870303. Using a generalized version of the Monte Carlo code of Wang et al. (1988,1989b), we model line formation by injecting continuum photons into a static plane-parallel slab of electrons threaded by a strong neutron star magnetic field (~ 10^12 G) which may be oriented at an arbitrary angle relative to the slab normal. We examine two source geometries, which we denote "1-0" and "1-1," with the numbers representing the relative electron column densities above and below the continuum photon source plane. We compare azimuthally symmetric models, i.e. models in which the magnetic field is parallel to the slab normal, with models having more general magnetic field orientations. If the bursting source has a simple dipole field, these two model classes represent line formation at the magnetic pole, or elsewhere on the stellar surface. We find that the data of S1 and S2, considered individually, are consistent with both geometries, and with all magnetic field orientations, with the exception that the S1 data clearly favor line formation away from a polar cap in the 1-1 geometry, with the best-fit model placing the line-forming region at the magnetic equator. Within both geometries, fits to the combined (S1+S2) data marginally favor models which feature equatorial line formation, and in which the observer's orientation with respect to the slab changes between the two epochs. We interpret this change as being due to neutron star rotation, and we place limits on the rotation period.Comment: LaTeX2e (aastex.cls included); 45 pages text, 17 figures (on 21 pages); accepted by ApJ (to be published 1 Nov 1999, v. 525

Diffuse-Charge Dynamics in Electrochemical Systems

The response of a model micro-electrochemical system to a time-dependent applied voltage is analyzed. The article begins with a fresh historical review including electrochemistry, colloidal science, and microfluidics. The model problem consists of a symmetric binary electrolyte between parallel-plate, blocking electrodes which suddenly apply a voltage. Compact Stern layers on the electrodes are also taken into account. The Nernst-Planck-Poisson equations are first linearized and solved by Laplace transforms for small voltages, and numerical solutions are obtained for large voltages. The ``weakly nonlinear'' limit of thin double layers is then analyzed by matched asymptotic expansions in the small parameter $\epsilon = \lambda_D/L$, where $\lambda_D$ is the screening length and $L$ the electrode separation. At leading order, the system initially behaves like an RC circuit with a response time of $\lambda_D L / D$ (not $\lambda_D^2/D$), where $D$ is the ionic diffusivity, but nonlinearity violates this common picture and introduce multiple time scales. The charging process slows down, and neutral-salt adsorption by the diffuse part of the double layer couples to bulk diffusion at the time scale, $L^2/D$. In the ``strongly nonlinear'' regime (controlled by a dimensionless parameter resembling the Dukhin number), this effect produces bulk concentration gradients, and, at very large voltages, transient space charge. The article concludes with an overview of more general situations involving surface conduction, multi-component electrolytes, and Faradaic processes.Comment: 10 figs, 26 pages (double-column), 141 reference