Enhanced catharanthine and vindoline production in suspension cultures of Catharanthus roseus by ultraviolet-B light

Suspension cultures of Catharanthus roseus were used to evaluate ultraviolet-B (UV-B) treatment as an abiotic elicitor of secondary metabolites. A dispersed cell suspension culture from C. roseus leaves in late exponential phase and stationary phase were irradiated with UV-B for 5 min. The stationary phase cultures were more responsive to UV-B irradiation than late exponential phase cultures. Catharanthine and vindoline increased 3-fold and 12-fold, respectively, on treatment with a 5-min UV-B irradiation

UV-B-induced signaling events leading to enhanced-production of catharanthine in Catharanthus roseus cell suspension cultures

<p>Abstract</p> <p>Background</p> <p>Elicitations are considered to be an important strategy towards improved <it>in vitro </it>production of secondary metabolites. In cell cultures, biotic and abiotic elicitors have effectively stimulated the production of plant secondary metabolites. However, molecular basis of elicitor-signaling cascades leading to increased production of secondary metabolites of plant cell is largely unknown. Exposure of <it>Catharanthus roseus </it>cell suspension culture to low dose of UV-B irradiation was found to increase the amount of catharanthine and transcription of genes encoding tryptophan decarboxylase (<it>Tdc</it>) and strictosidine synthase (<it>Str</it>). In the present study, the signaling pathway mediating UV-B-induced catharanthine accumulation in <it>C. roseus </it>suspension cultures were investigated.</p> <p>Results</p> <p>Here, we investigate whether cell surface receptors, medium alkalinization, Ca²⁺influx, H₂O₂, CDPK and MAPK play required roles in UV-B signaling leading to enhanced production of catharanthine in <it>C. roseus </it>cell suspension cultures. <it>C. roseus </it>cells were pretreated with various agonists and inhibitors of known signaling components and their effects on the accumulation of <it>Tdc </it>and <it>Str </it>transcripts as well as amount of catharanthine production were investigated by various molecular biology techniques. It has been found that the catharanthine accumulation and transcription of <it>Tdc </it>and <it>Str </it>were inhibited by 3–4 fold upon pretreatment of various inhibitors like suramin, N-acetyl cysteine, inhibitors of calcium fluxes, staurosporine <it>etc</it>.</p> <p>Conclusion</p> <p>Our results demonstrate that cell surface receptor(s), Ca²⁺influx, medium alkalinization, CDPK, H₂O₂and MAPK play significant roles in UV-B signaling leading to stimulation of <it>Tdc </it>and <it>Str </it>genes and the accumulation of catharanthine in <it>C. roseus </it>cell suspension cultures. Based on these findings, a model for signal transduction cascade has been proposed.</p

Enhanced cytotoxic and apoptosis inducing activity of lycopene oxidation products in different cancer cell lines

Currently, upon understanding the metabolomics of carotenoids, it is important to address the key role of carotenoid derived products. In this regard, aim of the study was to elucidate and explore the role of lycopene (LYC) oxidative products generated through autoxidation (AOL) or chemical (KMnO4) oxidation (COL) against proliferation of selected cancer cells. Preliminary, we investigated the effect of LYC on cell viability of various cancer cell lines (PC-3, MCF-7, A431, HepG2, HeLa and A549). Based on the results of LYC treatment on cell cytotoxicity levels, MCF-7, PC-3 and HeLa cell lines were further tested with AOL and COL products. The decreased cell viability with depleted GSH and increased MDA levels were observed when treated with COL products than control, LYC and AOL. In addition, COL products increased ROS levels and percent apoptosis. The typical morphological changes and nuclear condensations showed that COL products have anti-proliferation and apoptosis inducing activity. Based on results, we hypothesized that ROS generation by LYC oxidation products may be one of intermediate step involved in apoptosis. The redox status and therapeutic approach of COL products in modulating ROS and induction of apoptosis in cancer cells were reported for the first time, to our knowledge. To conclude, COL products involves in cancer growth inhibition efficiently than intact LYC and AOL. Hence, there is a great potential for synthesizing or producing such carotenoid oxidation products to augment cancer complication

Variations in the levels of aminoacylation and modified nucleotide content between total tRNAs from chloroplasts and etioplasts in cucumber cotyledons

Total tRNAs isolated from chloroplasts and etioplasts of cucumber cotyledons were compared with respect toamino acid acceptance, isoacceptor distribution and extent of modification. Aminoacylation of the tRNAs with nine different amino acids studied indicated that the relative acceptor activities of chloroplast total tRNAs for four amino acids are significantly higher than etioplast total tRNAs. Two dimensional polyacrylamide gel electrophoresis(2D-PAGE) of chloroplast total tRNAs separated at least 32 spots, while approximately 41 spots were resolved from etioplast total tRNAs. Comparison of the reversed-phase chromatography (RPC-5) profiles of chloroplast and etioplast leucyl-, lysyl-, phenylalanyl-, and valyl-tRNA species showed no qualitative differences in the elution profiles. However, leucyl-, lysyl- and valyl-tRNA species showed quantitative differences in the relative amounts of the isoaccepting species present in chloroplasts and etioplasts. The analysis of modified nucleotides of total tRNAs from the two plastid types indicated that total tRNA from etioplasts was undermodified with respect to ribothymidine, isopentenyladenosine/hydroxy-isopentenyladenosine, 1 -methylguanosine and 2-o-methylguanosine. This indicates that illumination may cause de novo synthesis of chloroplast tRNAmodifying enzymes encoded for by nuclear genes leading to the formation of highly modified tRNAs in chloroplasts. Based on these results, we speculate that the observed decrease in levels of aminoacylation, variations in the relative amounts of certain isoacceptors, and differences in the electrophoretic mobilities of some extra tRNA spots in the etioplast total tRNAs as compared to chloroplast total tRNAs could be due to some partially undermodified etioplast tRNAs. Taken together, the data suggested that the light-induced transformation of etioplasts into chloroplasts is accompanied by increases in the relative levels of some functional chloroplast tRNAs by post transcriptional nucleotide modifications

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro