Generation of induced pluripotent stem cells from peripheral blood CD34+ hematopoietic progenitors of a 31 year old healthy woman

The MUi019-A human induced pluripotent stem cell line was generated from peripheral blood CD34+ hematopoietic progenitors of a healthy woman using a non-integrative reprogramming method. Episomal vectors carrying reprogramming factors OCT4, SOX2, KLF4, L-MYC, LIN28, and shRNA of TP53 and EBNA-1 were delivered using electroporation. The iPSC line can be used as a control in studying disease mechanisms. Furthermore, gene editing approaches can be used to introduce specific mutations into the MUi019-A to model disease while the cell type affected by the disease is inaccessible

Generation of a human induced pluripotent stem cell line (MUi010-A) from skin fibroblast of patient carrying a c.2104C>T mutation in MYH9 gene

Mutations in MYH9 gene is one of the major causes of inherited thrombocytopenia resulted from nonfunctional myosin-9 protein. We have generated a human induced pluripotent stem cell line MUi010-A from skin fibroblasts of a patient who had a point mutation c.2104C>T (p.R702C) in the exon 16 of MYH9 gene using a non-integrative reprogramming method. The MUi010-A exhibited embryonic stem cell-like characteristics with consistent pluripotent markers expression, was capable of all three embryonic germ layers differentiation, and had a normal karyotype

Generation of iPSC line MU011.A-hiPS from homozygous α-thalassemia fetal skin fibroblasts

Human iPSC line MU011.A-hiPS was generated from homozygous α-thalassemia (−SEA/−SEA) fetal skin fibroblasts using a non-integrative reprogramming method. Reprogramming factors OCT3/4, SOX2, KLF4, L-MYC, LIN28, and shRNA of TP53 contained in three episomal vectors were delivered using electroporation

A novel anti-membrane CD30 single-chain variable fragment discovered from the human phage library: A potential targeted immunotherapy.

Hodgkin's lymphoma and anaplastic large cell lymphoma, especially relapsed or refractory diseases, could recently be cured by CD30-targeted immunotherapy. However, the CD30 antigen releases the soluble ectodomain of CD30, which might obscure the targeted therapy. Therefore, the membrane epitope of CD30 (mCD30), left on the cancer cells, might be a prospective target for lymphoma treatment. The discovery of novel mCD30 monoclonal antibodies (mAbs) using phage technology yielded 59 potential human single-chain variable fragments (HuscFvs). Ten candidate HuscFv clones have been selected based on various methods, i.e., direct PCR, ELISA and western blot assays, and nucleotide sequencing techniques. Fortunately, only one potential HuscFv clone, clone #A4, was determined by the prediction of HuscFv-peptide molecular docking and the binding affinity test using isothermal titration calorimetry. Finally, we proved that the HuscFv #A4, which had a binding affinity (Kd) of 421e-9 ± 2.76e-6 M, might be the novel mCD30 mAb. We generated chimeric antigen receptor-modified T lymphocytes using HuscFv #A4 as an antigen detection part (anti-mCD30-H4CART). The cytotoxicity assay of anti-mCD30-H4CART cells showed significant eradication of the CD30-expressing cell line, K562 (p = 0.0378). We found a novel mCD30 HuscFv using human phage technology. We systematically examined and proved that our HuscFv #A4 could specifically eradicate CD30-expressing cancers

The thermodynamic parameters of the purified protein binding determined by the isothermal titration calorimetry (ITC).

Titrations of membrane CD30 (mCD30) and recombinant CD30 (rCD30) peptides into the ScFv#A4 and the ScFv#AK (positive control) revealed an exothermic association based on favorable enthalpy and unfavorable entropy with a binding affinity (Kd) of 421 nM and 1 pM, respectively. The stoichiometry (N) of the ScFv#A4 and the ScFv#AK showed 1.66 ± 1.93 and 1.10 ± 2.87, respectively. (n = 3). (DOCX)</p

The calculation of transduction efficiency (%TE) by RT-PCR.

The standard curve was performed using 50 ng of gDNA, which was referred to as cell number 7575.5 cells, plus various amounts of amplicon in each copy number starting from 103 to 109 copies. By which the amount of amplicon in each copy number was calculated from the formula below. x: the amount of amplicon (ng) N: the length of the dsDNA amplicon Fifty ng of gDNA samples were used to amplify with RT-PCR. The starting quantity (SQ) from the amplification curve was used as a copy number of the sample to calculate the percentage of transduction efficiency (%TE), as shown in the formula below. %TE = copy number/cell number * 100 Primer forward sequence: CTGGCAGGAACATGTGGCGT Primer reverse sequence: CGTGGCTTGCCTCCCATCTC Probe: GCCGCTCCGCCGACGCACCA 50 ng of gDNA = 7575.5 cells Amplification curves and standard curves (n = 4). (TIF)</p

The detection of CD30 expression.

The CD30 antigen on the cell surface of healthy target cell lines (K562 and SupB15) was stained with PE anti-human CD30 antibody, and the expression was detected by flow cytometry. CD30 expresses at a consistently high level on the cell surface of K562 cells but not of SupB15 cells. The black-shaded histogram represented the unstain, and the blue showed CD30 staining. (TIF)</p

Clonal selection of mCD30-bound ScFvs.

(A) The screening of E. coli clones that produced mCD30-bound ScFvs by indirect ELISA used the mCD30 peptide as a peptide-coated plate and the blocking buffer as a non-coated plate (negative control) in the side-by-side wells. Bound ScFvs were selected from the OD405nm signal above the mean + 3 SD of the background binding control (lysate of original E. coli HB2151; HB) (cut off = 0.03875). Lysates of 12 scFv-positive E. coli clones (#A3, A4, A8, A10, A14, A15, A17, A31, A32, A35, A36, and A37) produced soluble ScFvs bound to the mCD30 peptide. (B) The statistical significance between the bound, unbound ScFvs groups and the HB control was analyzed by one-way ANOVA and Tukey’s post hoc test.</p