Monoclonal Antibody Dimers Induced by Low pH, Heat, or Light Exposure Are Not Immunogenic Upon Subcutaneous Administration in a Mouse Model

The presence of protein aggregates is commonly believed to be an important risk factor for immunogenicity of therapeutic proteins. Among all types of aggregates, dimers are relatively abundant in most commercialized monoclonal antibody (mAb) products. The aim of this study was to investigate the immunogenicity of artificially created mAb dimers relative to that of unstressed and stressed mAb monomers. A monoclonal murine IgG1 (mIgG1) antibody was exposed to low pH, elevated temperature, or UV irradiation to induce dimerization. Dimers and monomers were purified via size-exclusion chromatography. Physicochemical analysis revealed that upon all stress conditions, new deamidation or oxidation or both of amino acids occurred. Nevertheless, the secondary and tertiary structures of all obtained dimers were similar to those of unstressed mIgG1. Isolated dimers were administered subcutaneously in Balb/c mice, and development of antidrug antibodies and accumulation of follicular T helper cells in draining lymph nodes and spleens were determined. None of the tested dimers or stressed monomers were found to be more immunogenic than the unstressed control in our mouse model. In conclusion, both dimers and monomers generated by using 3 different stress factors have a low immunogenicity similar to that of the unstressed monomers.Biopharmaceutic

Submicron size particles of a murine monoclonal antibody are more immunogenic than soluble oligomers or micron size particles upon subcutaneous administration in mice

Protein aggregates are one of several risk factors for undesired immunogenicity of biopharmaceuticals. However, it remains unclear which features determine whether aggregates will trigger an unwanted immune response. The aim of this study was to determine the effect of aggregates' size on their relative immunogenicity. A monoclonal murine IgG1 was stressed by exposure to low pH and elevated temperature followed by stirring to obtain aggregates widely differing in size. Aggregate fractions enriched in soluble oligomers, submicron size particles and micron size particles were isolated via centrifugation or size-exclusion chromatography and characterized physicochemically. The secondary and tertiary structures of aggregates were altered in a similar way for all the fractions, while no substantial chemical degradation was observed. Development of anti-drug antibodies was measured after subcutaneous administration of each enriched fraction to BALB/c mice. Among all tested fractions, the most immunogenic was the one highly enriched in submicron size particles (∼100-1000 nm). Fractions composed of micron size (> 1 μm to 100 μm) particles or soluble oligomers (< 100 nm) were not immunogenic under the dosing regimen studied in this work. These results show that aggregate size is an important factor for protein immunogenicity.Drug Delivery Technolog

Tetraplex PCR assay involving double gene-sites discriminates beef and buffalo in Malaysian meat curry and burger products

Replacement of beef by buffalo and vice versa is frequent in global markets, but their authentication is challenging in processed foods due to the fragmentation of most biomarkers including DNA. The shortening of target sequences through use of two target sites might ameliorate assay reliability because it is highly unlikely that both targets will be lost during food processing. For the first time, we report a tetraplex polymerase chain reaction (PCR) assay targeting two different DNA regions in beef (106 and 120-bp) and buffalo (90 and 138-bp) mitochondrial genes to discriminate beef and buffalo in processed foods. All targets were stable under boiling, autoclaving and microwave cooking conditions. A survey in Malaysian markets revealed 71% beef curries contained buffalo but there was no buffalo in beef burgers. The assay detected down to 0.01 ng DNA and 1% meat in admixed and burger products

Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations

Search for displaced vertices arising from decays of new heavy particles in 7 TeV pp collisions at ATLAS

We present the results of a search for new, heavy particles that decay at a significant distance from their production point into a final state containing charged hadrons in association with a high-momentum muon. The search is conducted in a pp-collision data sample with a center-of-mass energy of 7 TeV and an integrated luminosity of 33 pb^-1 collected in 2010 by the ATLAS detector operating at the Large Hadron Collider. Production of such particles is expected in various scenarios of physics beyond the standard model. We observe no signal and place limits on the production cross-section of supersymmetric particles in an R-parity-violating scenario as a function of the neutralino lifetime. Limits are presented for different squark and neutralino masses, enabling extension of the limits to a variety of other models.Comment: 8 pages plus author list (20 pages total), 8 figures, 1 table, final version to appear in Physics Letters

Measurement of the polarisation of W bosons produced with large transverse momentum in pp collisions at sqrt(s) = 7 TeV with the ATLAS experiment

This paper describes an analysis of the angular distribution of W->enu and W->munu decays, using data from pp collisions at sqrt(s) = 7 TeV recorded with the ATLAS detector at the LHC in 2010, corresponding to an integrated luminosity of about 35 pb^-1. Using the decay lepton transverse momentum and the missing transverse energy, the W decay angular distribution projected onto the transverse plane is obtained and analysed in terms of helicity fractions f0, fL and fR over two ranges of W transverse momentum (ptw): 35 < ptw < 50 GeV and ptw > 50 GeV. Good agreement is found with theoretical predictions. For ptw > 50 GeV, the values of f0 and fL-fR, averaged over charge and lepton flavour, are measured to be : f0 = 0.127 +/- 0.030 +/- 0.108 and fL-fR = 0.252 +/- 0.017 +/- 0.030, where the first uncertainties are statistical, and the second include all systematic effects.Comment: 19 pages plus author list (34 pages total), 9 figures, 11 tables, revised author list, matches European Journal of Physics C versio

Observation of a new chi_b state in radiative transitions to Upsilon(1S) and Upsilon(2S) at ATLAS

The chi_b(nP) quarkonium states are produced in proton-proton collisions at the Large Hadron Collider (LHC) at sqrt(s) = 7 TeV and recorded by the ATLAS detector. Using a data sample corresponding to an integrated luminosity of 4.4 fb^-1, these states are reconstructed through their radiative decays to Upsilon(1S,2S) with Upsilon->mu+mu-. In addition to the mass peaks corresponding to the decay modes chi_b(1P,2P)->Upsilon(1S)gamma, a new structure centered at a mass of 10.530+/-0.005 (stat.)+/-0.009 (syst.) GeV is also observed, in both the Upsilon(1S)gamma and Upsilon(2S)gamma decay modes. This is interpreted as the chi_b(3P) system.Comment: 5 pages plus author list (18 pages total), 2 figures, 1 table, corrected author list, matches final version in Physical Review Letter

Measurement of the inclusive isolated prompt photon cross-section in pp collisions at sqrt(s)= 7 TeV using 35 pb-1 of ATLAS data

A measurement of the differential cross-section for the inclusive production of isolated prompt photons in pp collisions at a center-of-mass energy sqrt(s) = 7 TeV is presented. The measurement covers the pseudorapidity ranges |eta|<1.37 and 1.52<=|eta|<2.37 in the transverse energy range 45<=E_T<400GeV. The results are based on an integrated luminosity of 35 pb-1, collected with the ATLAS detector at the LHC. The yields of the signal photons are measured using a data-driven technique, based on the observed distribution of the hadronic energy in a narrow cone around the photon candidate and the photon selection criteria. The results are compared with next-to-leading order perturbative QCD calculations and found to be in good agreement over four orders of magnitude in cross-section.Comment: 7 pages plus author list (18 pages total), 2 figures, 4 tables, final version published in Physics Letters

Search for direct production of charginos and neutralinos in events with three leptons and missing transverse momentum in √s = 7 TeV pp collisions with the ATLAS detector

A search for the direct production of charginos and neutralinos in final states with three electrons or muons and missing transverse momentum is presented. The analysis is based on 4.7 fb−1 of proton–proton collision data delivered by the Large Hadron Collider and recorded with the ATLAS detector. Observations are consistent with Standard Model expectations in three signal regions that are either depleted or enriched in Z-boson decays. Upper limits at 95% confidence level are set in R-parity conserving phenomenological minimal supersymmetric models and in simplified models, significantly extending previous results

Jet size dependence of single jet suppression in lead-lead collisions at sqrt(s(NN)) = 2.76 TeV with the ATLAS detector at the LHC

Measurements of inclusive jet suppression in heavy ion collisions at the LHC provide direct sensitivity to the physics of jet quenching. In a sample of lead-lead collisions at sqrt(s) = 2.76 TeV corresponding to an integrated luminosity of approximately 7 inverse microbarns, ATLAS has measured jets with a calorimeter over the pseudorapidity interval |eta| < 2.1 and over the transverse momentum range 38 < pT < 210 GeV. Jets were reconstructed using the anti-kt algorithm with values for the distance parameter that determines the nominal jet radius of R = 0.2, 0.3, 0.4 and 0.5. The centrality dependence of the jet yield is characterized by the jet "central-to-peripheral ratio," Rcp. Jet production is found to be suppressed by approximately a factor of two in the 10% most central collisions relative to peripheral collisions. Rcp varies smoothly with centrality as characterized by the number of participating nucleons. The observed suppression is only weakly dependent on jet radius and transverse momentum. These results provide the first direct measurement of inclusive jet suppression in heavy ion collisions and complement previous measurements of dijet transverse energy imbalance at the LHC.Comment: 15 pages plus author list (30 pages total), 8 figures, 2 tables, submitted to Physics Letters B. All figures including auxiliary figures are available at http://atlas.web.cern.ch/Atlas/GROUPS/PHYSICS/PAPERS/HION-2011-02