Feature Detection Techniques for Preprocessing Proteomic Data

Numerous gel-based and nongel-based technologies are used to detect protein changes potentially associated with disease. The raw data, however, are abundant with technical and structural complexities, making statistical analysis a difficult task. Low-level analysis issues (including normalization, background correction, gel and/or spectral alignment, feature detection, and image registration) are substantial problems that need to be addressed, because any large-level data analyses are contingent on appropriate and statistically sound low-level procedures. Feature detection approaches are particularly interesting due to the increased computational speed associated with subsequent calculations. Such summary data corresponding to image features provide a significant reduction in overall data size and structure while retaining key information. In this paper, we focus on recent advances in feature detection as a tool for preprocessing proteomic data. This work highlights existing and newly developed feature detection algorithms for proteomic datasets, particularly relating to time-of-flight mass spectrometry, and two-dimensional gel electrophoresis. Note, however, that the associated data structures (i.e., spectral data, and images containing spots) used as input for these methods are obtained via all gel-based and nongel-based methods discussed in this manuscript, and thus the discussed methods are likewise applicable

Redox proteomic profiling of neuroketal-adducted proteins in human brain: regional vulnerability at middle age increases in the elderly

Protein lipoxidation was assessed in the parietal cortex (PC), frontal cortex (FC), and cingulate gyrus (CG) in middle-aged and old-aged individuals with no clinical manifestations of cognitive impairment, in order to increase understanding of regional brain vulnerability to oxidative damage during aging. Twenty-five lipoxidized proteins were identified in all the three regions although with regional specificities, by using redox proteomics to detect target proteins of neuroketals (NKT) adduction. The number of cases with NKT-adducted proteins was higher in old-aged individuals but most oxidized proteins were already present in middle-aged individuals. Differences in vulnerability to oxidation were dependent on the sub-cellular localization, secondary structure, and external exposition of certain amino acids. Lipoxidized proteins included those involved in energy metabolism, cytoskeleton, proteostasis, neurotransmission and O2/CO2, and heme metabolism. Total NKT and soluble oligomer levels were estimated employing slot-blot, and these were compared between age groups. Oligomers increased with age in PC and FC; NKT significantly increased with age in FC, whereas total NKT and oligomer levels were not modified in CG, thus highlighting differences in brain regional vulnerability with age. Oligomers significantly correlated with NKT levels in the three cortical regions, suggesting that protein NKT adduction parallels soluble oligomer formation

A systematic analysis of the effects of increasing degrees of serum immunodepletion in terms of depth of coverage and other key aspects in top-down and bottom-up proteomic analyses

Immunodepletion of clinical fluids to overcome the dominance by a few very abundant proteins has been explored but studies are few, commonly examining only limited aspects with one analytical platform. We have systematically compared immunodepletion of 6, 14, or 20 proteins using serum from renal transplant patients, analysing reproducibility, depth of coverage, efficiency, and specificity using 2-D DIGE (‘top-down’) and LC-MS/MS (‘bottom-up’). A progressive increase in protein number (≥2 unique peptides) was found from 159 in unfractionated serum to 301 following 20 protein depletion using a relatively high-throughput 1-D-LC-MS/MS approach, including known biomarkers and moderate–lower abundance proteins such as NGAL and cytokine/growth factor receptors. On the contrary, readout by 2-D DIGE demonstrated good reproducibility of immunodepletion, but additional proteins seen tended to be isoforms of existing proteins. Depletion of 14 or 20 proteins followed by LC-MS/MS showed excellent reproducibility of proteins detected and a significant overlap between columns. Using label-free analysis, greater run-to-run variability was seen with the Prot20 column compared with the MARS14 column (median %CVs of 30.9 versus 18.2%, respectively) and a corresponding wider precision profile for the Prot20. These results illustrate the potential of immunodepletion followed by 1-D nano-LC-LTQ Orbitrap Velos analysis in a moderate through-put biomarker discovery process

Identification and characterisation of South African strains of cucumber mosaic virus

Bibliography: pages 107-112.This project was then aimed at finding naturally occurring isolates of CMV, characterising them, producing much needed antisera and to use such antisera in a comparison with other well characterised strains by the use of new contemporary sensitive serological techniques

Structural and functional studies of AT-Rich DNA ligands and their effect on trypanosoma brucei

AT-rich sequences confer unique properties to DNA, such as high polymorphism and flexibility. The abundance of AT-rich DNA in several pathogens' genomes and the ability of specific molecules to selectively target AT base pairs have prompted studies on ligands that interact with the minor groove of high AT content DNA. Of special interest are kinetoplastid parasites, such as Trypanosoma brucei, the causative agent of sleeping sickness, which are distinguished by the presence of a very AT-rich mitochondrial DNA structure called kinetoplast. Minor groove binding ligands have offered critical information on DNA molecular recognition, providing clinically useful strategies against diseases. Thus, the binding affinity and structural characteristics of AT-rich oligonucleotides in complex with different ligands, specifically with HMG proteins and bisimidazolinium compounds, has been chosen as the object of study. The `High Mobility Group¿ (HMG) is a family of architectural proteins that bind to DNA and influence a myriad of essential cellular processes. This research work has focused in two HMG subfamilies: HMGA and HMGB. They bind to the minor groove of the DNA by means of AT-hook (HMGA) or HMG-box (HMGB) domains. HMGA1a(50-91), HMGB1 box B and HMGB1 box AB have been expressed and purified. High similar binding affinity to an AT-rich DNA sequence containing [AATAAT_ATTATT] has been found by SPR¿biosensor experiments for both proteins. A d[CCAATAATCGCGATTATTGG]2-HMGB1 box B complex was crystallized. The diffraction patterns of the crystal at 2.68 Å resolution presented well-defined spots revealing two diffraction orientations. A series of derivatives of FR60 [4-((4,5-dihydro-1H-imidazol-2-yl)amino)-N-(4-((4,5-dihydro-1Himidazol-2-yl)amino)phenyl)benzamide] have been proved to be high affinity DNA binders with a preference for AT over GC-rich DNA, showing slight selectivity towards sequences containing [AATT] versus [(AT)4] or [AATAAT_ATTATT]. Furthermore, competition assays have demonstrated that JNI18 competes with HMGA1a and HMGB1 for binding to DNA and it is able to displace the proteins from their DNA binding sites. This last interaction is of prime importance, as related proteins have been found to be essential in kinetoplastid parasites. The structure of the bis(2-aminoimidazoline) compound CDIV32 with the oligonucleotide d[AAATTT]2 partially solved at 3.10 Å resolution, displays DNA columns of stacked oligonucleotides forming apseudo-continuous helix packed in a crossed column configuration of DNA helices that are at ~90° to each other. The presence of the drug CDIV32 modulates the organization of duplexes. The crystal structure of the complex of the oligonucleotide d[AAATTT]2 with the lead compound FR60, solved at atomic resolution of 1.25 Å (PDB-ID: 5LIT) by X-ray crystallography, is constituted of stacked oligonucleotides organized as infinite continuous parallel columns, packed in a pseudo-tetragonal configuration. The structure revealed that the drug interacts with the central [AATT] region, covers the minor groove of DNA, displaces bound water and interacts with neighboring DNA molecules as a crosslinking agent. Finally, a functional analysis has been performed on the effect of different bis(2-aminoimidazolines) on T.brucei (>70% AT kDNA) to assess whether parasite DNA was a target for these compounds. By a combination of flow cytometry and imaging techniques such as fluorescence microscopy and TEM, it was demonstrated that these compounds have a clear effect on the S-phase of T. brucei cell cycle by inflicting specific damage on the kinetoplast. It can be concluded that the studied DNA binding compounds FR60 and JNI18 are powerful trypanocides that act directly on the kinetoplast DNA. As the compounds show 100% curative activity in a mouse model of T. b. rhodesiense infection, they are potentially an effective chemotherapeutic agent for the treatment of sleeping sickness.Las secuencias ricas en AT le confieren al ADN propiedades únicas como un alto polimorfismo y flexibilidad. Su abundancia en el genoma de varios patógenos y la selectividad de unión a secuencias AT que presentan ciertas moléculas, han llevado al estudio de ligandos que interactúan con el surco estrecho de DNA con alto contenido en AT. De especial interés son los parásitos kinetoplástidos, como el Trypanosoma brucei, agente causante de la enfermedad del sueño, los cuales se distinguen por la presencia de una estructura de ADN mitocondrial muy rica en AT llamada kinetoplasto. Los ligandos de unión al surco estrecho han ofrecido información primordial sobre el reconocimiento molecular del ADN, proporcionando estrategias terapéuticas útiles. Por ello, se ha elegido como objeto de estudio complejos de ADN ricos en AT con diferentes ligandos, específicamente con proteínas HMG y compuestos bisimidazolinio. Las HMG son una familia de proteínas arquitectónicas que se unen al ADN e influyen en numerosos procesos celulares esenciales. En este trabajo se han estudiado dos subfamilias de las HMG: HMGA y HMGB. Ambas se unen al surco estrecho del ADN mediante diferentes motivos de unión: AT-hook (HMGA) y HMG-box (HMGB). Se han expresado y purificado las formas HMGA1a(50-91), HMGB1 box B y HMGB1 box AB. Mediante SPR, ambas proteínas presentaron una afinidad de unión alta y similar hacia un ADN conteniendo la secuencia [AATAAT_ATTATT]. Se cristalizó el complejo d[CCAATAATCGCGATTATTGG]2- HMGB1 box B. La difracción a una resolución de 2.68 Å presentó reflexiones bien definidas que indicaban dos orientaciones preferenciales. Una serie de derivados del compuesto FR60 [4-((4,5-dihidro-1H-imidazol-2-il)amino)-N-(4-((4,5-dihidro-1H-imidazol-2-il)amino)fenil)benzamida] han demostrado ser ligandos de alta afinidad por secuencias AT con respecto a GC, mostrando cierta preferencia hacia secuencias con [AATT] comparado con [(AT)4] o [AATAAT_ATTATT]. Además, se ha demostrado que el JNI18 compite con la HMGA1a y la HMGB1 en su unión al ADN y es capaz de desplazar a dichas proteínas de sus sitios de unión al ADN. Este hecho es de especial relevancia, ya que se han encontrado proteínas relacionadas que son esenciales en parásitos kinetoplástidos. La estructura del compuesto de bis(2-aminoimidazolinio) CDIV32 con el oligonucleótido d[AAATTT]2 ha sido parcialmente resuelta a una resolución de 3.10 Å. Se encontraron columnas de oligonucleótidos apilados formando una hélice pseudo-continua, empaquetada en una configuración de columnas cruzadas perpendicularmente. La presencia del fármaco CDIV32 modula la organización de las hélices de ADN. Se ha resuelto la estructura cristalográfica del complejo d[AAATTT]2-FR60 a resolución atómica de 1.25 Å (PDB-ID: 5LIT). Se encontraron los oligonucleótidos apilados organizados en columnas infinitas y paralelas en una configuración pseudo-tetragonal. El fármaco interacciona con la región central [AATT], ocupa el surco estrecho del ADN, desplaza las moléculas de agua presentes e interactúa con moléculas de ADN vecinas como un agente entrecruzador. Finalmente, se ha realizado un análisis funcional del efecto de diferentes compuestos bis(2-aminoimidazolinio) en T. brucei (con >70% de AT en su kDNA) para evaluar si el ADN del parásito es una diana para estos compuestos. Se ha estudiado su efecto in vitro mediante una combinación decitometría de flujo y técnicas como microscopía de fluorescencia y TEM. Los resultados permitieron demostrar que estos compuestos tienen un efecto claro sobre la fase S del ciclo celular de T. brucei al dañar específicamente el kinetoplasto. Se ha podido concluir que los compuestos FR60 y JNI18 son potentes tripanocidas que actúan directamente sobre el ADN del kinetoplasto. Ya que los compuestos muestran una actividad curativa del 100% en un modelo de ratón infectado por T. b. rhodesiense, representan un agente quimioterapéutico potencialmente eficaz para el tratamiento de la enfermedad del sueño.Postprint (published version

Novel methods for proteomics analysis of formalin-fixed, paraffin-embedded tissues (FFPE), and their application for biomarker discovery

A wealth of information on proteins involved in many aspects of disease is encased within formalin-fixed paraffin-embedded (FFPE) tissue repositories stored in hospitals worldwide. However, FFPE protein extracts, as described to date, often exhibit a low pattern complexity, and a poor suitability for downstream gel-based proteomic techniques. Thus, an optimised method for extraction of full-length proteins from FFPE tissues was developed. The results obtained analysing FFPE muscle, liver, and thyroid extracts, by GeLC-MS/MS, western immunoblotting, protein arrays, and ELISA, are presented and discussed. Moreover, 2D-PAGE-MS and 2D-DIGE-MS analyses of proteins extracted from fixed skeletal muscle and liver tissues are reported. Finally, the application of 2D-DIGE-MS and GeLC-MS/MS for differential proteomic investigation of FFPE diseased samples was pursued. First, a proteomic comparison between sheep pathological liver samples was carried out, and several stress biomarkers were detected. Subsequently, a thorough biomarker discovery study was conducted, analysing human lung neuroendocrine cancer tissues. GeLC-MS/MS analysis of 3 typical carcinoid and 3 small cell lung carcinoma cases led to the identification of over 400 unique proteins per disease class. According to statistical analysis, a panel of over 30 differentially expressed putative biomarkers is presented. In addition, also 2D-DIGE-MS data clearly support biomarkers identification