An Empirical Assessment of the Business Value Derived from Implementing Mobile Technology: A Case Study of Two Organizations

Mobile technologies are argued to offer unprecedented opportunities for organizations and individuals. In order for organizations to be persuaded that investment in mobile technologies is not only worthwhile, but also important to the achievement of corporate goals and objectives, then it is important to evaluate the potential of mobile technology so that the derivation of business value and the related risks involved in implementing mobile devices and services in an organization can be understood. This paper aims at understanding the organizational value that could be derived from investments in mobile technology. We present two in-depth case studies of mobile technology implementation in health care organizations. These studies show that deriving business value from the adoption and implementation of mobile devices does not seem at all certain, but is contingent upon clear business objectives and a willingness to make business changes to embrace the transformation to core business processes which are driven by the mobile technologies

Facile Synthesis of Oligodeoxyribonucleotides via the Phosphoramidite Method without Nucleoside Base Protection

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in >95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include 5‘GTCACGACGTTGTAAAACGAC3‘ (21mer), 5‘CAGGAAACAG-CTATGACCATG3‘ (21mer), 5‘CAAGTTGATGAACAATACTTCATACCTAAACT3‘ (32mer), and 5‘TATGGGCCTTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTTATT3‘ (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated

Preparation of Short Oligonucleotides via the Phosphoramidite Method Using a Tetrazole Promoter in a Catalytic Manner

A facile phosphoramidite method using a tetrazole promoter in a catalytic manner has been developed for the condensation of a nucleoside 3‘-phosphoramidite and a nucleoside. This method is particularly useful for a large-scale synthesis of short oligonucleotides. For example, dinucleoside phosphates are prepared on a multigram scale in 92−99% yields through the reaction of nucleoside 3‘-N,N-diethylphosphoramidites (1.05 equiv) and 5‘-O-free nucleosides (1.00 equiv) with 5-(p-nitrophenyl)-1H-tetrazole (NPT) (0.05 equiv) in the presence of molecular sieves 13X in acetonitrile (40 °C, 60 min) followed by trimethylsilyl triflate-catalyzed oxidation with bis(trimethylsilyl) peroxide in dichloromethane (40 °C, 10 min). The NPT-catalytic approach is also effective for the synthesis of longer deoxyribonucleotides such as d(5‘CTACCTGT3‘) and 2‘−5‘- or 3‘−5‘-linked ribonucleotides

A Convenient Method for the Synthesis of N-Free 5‘-<i>O</i>-(<i>p</i>,<i>p</i>‘-Dimethoxytrityl)-2‘- deoxyribonucleosides via the 5‘-O-Selective Tritylation of the Parent Substances

A Convenient Method for the Synthesis of N-Free 5‘-O-(p,p‘-Dimethoxytrityl)-2‘- deoxyribonucleosides via the 5‘-O-Selective Tritylation of the Parent Substance

Benzimidazolium Triflate as an Efficient Promoter for Nucleotide Synthesis via the Phosphoramidite Method

Benzimidazolium Triflate as an Efficient Promoter for Nucleotide Synthesis via the Phosphoramidite Metho

The different effects on each pathway by experiment-based classification.

<p>(A) Relative luciferase activity by each crude drug/herb was normalized to that of the vehicle control. The averages of relative luciferase activity of two major groupings containing exterior-resolving herbs (n = 50, filled bars) and others (n = 62, open bars) are shown. Data are the means ± S.D. of each grouping. *<i>p</i> <0.01 by two-way ANOVA followed by the Bonferroni <i>post-hoc</i> test compared with exterior-resolving medicines and others. (B) The averages of relative luciferase activity of each major groupings containing the acrid and warm exterior-resolving herbs (n = 24, filled bars) and the acrid and cool exterior-resolving herbs (n = 26, shadow bars) are shown. *<i>p</i> <0.01 by two-way ANOVA followed by the Bonferroni <i>post-hoc</i> test compared with warm and cool exterior-resolving medicines. Other conditions are similar to Fig 3A. (C) A549 cells were treated with vehicle (open bars), Perilla Herb (filled bars) or Bupleurum Root (shadow bars) for 48 h. NR4A1 (left panel) or HSP90B1 (right panel) was quantified by real-time RT-PCR. Relative mRNA expression was normalized to the value of each mRNA in vehicle-treated cells. Data are shown as the mean ± SD of three independent experiments.</p

Schematic outline of the multi-pathway analysis using 112 extracts of crude drugs/herbs.

<p>A549 cells were co-transfected with the reporter plasmids containing the transcription factor-binding site upstream of the luciferase gene with the <i>Renilla</i> luciferase gene. After the addition of the extract of crude drugs/herbs at 100 μg/ml, the cell lysates were subjected to dual-luciferase assay. The luciferase activity of each crude drug/herb was normalized to that of the vehicle control. The result of CREB reporter was shown as an example. Data are mean of two independent experiments. The hierarchical clustering and heatmap were performed using the R statistical package.</p

Panel of multi-pathway analysis of 112 crude drugs/herbs.

<p>Heatmap of activity levels of 112 crude drugs/herbs across 10 reporters. Activity levels were indicated by Z-scores calculated from the relative transcriptional activities of individual crude drugs/herbs across different reporters, and by colors presented at the top of the figure. The crude drugs/herbs belonging to three traditional conceptions (heat-clearing and dampness-drying herbs, the acrid and warm exterior-resolving herbs, and the acrid and cool exterior-resolving herbs) are shown in green, red, and blue, respectively. Five major groupings are shown as the lines on the tree of crude drugs/herbs, and the enriched major groupings of three traditional conceptions are shown in green, red, and blue, respectively. **<i>P</i> <0.01 and *<i>P <0</i>.<i>05</i> by chi-square test.</p

Controlling Glycosyl Bond Conformation of Guanine Nucleosides: Stabilization of the anti Conformer in 5′-<i>O</i>-Ethylguanosine

Nucleosides that consist of base and sugar moieties can adopt two main conformations, syn and anti, about the glycosidic bond. We have investigated the conformational properties of guanine nucleosides in the gas phase by using laser desorption combined with IR–UV double resonance spectroscopy. In guanosine, syn conformation is preferred as a result of internal hydrogen bonding between the 5′-OH group of the sugar and the N3 site of the guanine moiety. We have therefore employed a chemically modified nucleoside 5′-<i>O</i>-ethylguanosine, in which possible glycosyl bond conformations are restricted upon ethylation of the 5′-OH group. The result shows that anti conformer is stabilized by the formation of hydrogen bonding involving the 2′-OH group

Identification of Ligand Analogues that Control c-di-GMP Riboswitches

Riboswitches for the bacterial second messenger c-di-GMP control the expression of genes involved in numerous cellular processes such as virulence, competence, biofilm formation, and flagella synthesis. Therefore, the two known c-di-GMP riboswitch classes represent promising targets for developing novel modulators of bacterial physiology. Here, we examine the binding characteristics of circular and linear c-di-GMP analogues for representatives of both class I and II c-di-GMP riboswitches derived from the pathogenic bacterium <i>Vibrio choleae</i> (class I) and <i>Clostridium difficile</i> (class II). Some compounds exhibit values for apparent dissociation constant (<i>K</i>_D) below 1 μM and associate with riboswitch RNAs during transcription with a speed that is sufficient to influence riboswitch function. These findings are consistent with the published structural models for these riboswitches and suggest that large modifications at various positions on the ligand can be made to create novel compounds that target c-di-GMP riboswitches. Moreover, we demonstrate the potential of an engineered allosteric ribozyme for the rapid screening of chemical libraries for compounds that bind c-di-GMP riboswitches