The development of an adaptive upper-limb stroke rehabilitation robotic system

<p>Abstract</p> <p>Background</p> <p>Stroke is the primary cause of adult disability. To support this large population in recovery, robotic technologies are being developed to assist in the delivery of rehabilitation. This paper presents an automated system for a rehabilitation robotic device that guides stroke patients through an upper-limb reaching task. The system uses a decision theoretic model (a partially observable Markov decision process, or POMDP) as its primary engine for decision making. The POMDP allows the system to automatically modify exercise parameters to account for the specific needs and abilities of different individuals, and to use these parameters to take appropriate decisions about stroke rehabilitation exercises.</p> <p>Methods</p> <p>The performance of the system was evaluated by comparing the decisions made by the system with those of a human therapist. A single patient participant was paired up with a therapist participant for the duration of the study, for a total of six sessions. Each session was an hour long and occurred three times a week for two weeks. During each session, three steps were followed: (A) after the system made a decision, the therapist either agreed or disagreed with the decision made; (B) the researcher had the device execute the decision made by the therapist; (C) the patient then performed the reaching exercise. These parts were repeated in the order of A-B-C until the end of the session. Qualitative and quantitative question were asked at the end of each session and at the completion of the study for both participants.</p> <p>Results</p> <p>Overall, the therapist agreed with the system decisions approximately 65% of the time. In general, the therapist thought the system decisions were believable and could envision this system being used in both a clinical and home setting. The patient was satisfied with the system and would use this system as his/her primary method of rehabilitation.</p> <p>Conclusions</p> <p>The data collected in this study can only be used to provide insight into the performance of the system since the sample size was limited. The next stage for this project is to test the system with a larger sample size to obtain significant results.</p

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from Agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid

State of Philanthropy Among Asian Americans and Pacific Islanders: Findings and Recommendations to Strengthen Visibility and Impact

Asian Americans and Pacific Islanders (AAPIs) have been an important part of the United States for over 170 years, and are the fastest-growing racial groups in the country today. AAPIs have made significant gains in political representation, from the halls of Congress to state and local offices. We have also seen important gains in understanding the demographic makeup and public opinion of Asian Americans and Pacific Islanders.Yet, when it comes to philanthropy, AAPIs continue to be rendered invisible and marginal. This report—based on a summary of prior findings and insights from several data collections, including prior population surveys, content analysis of philanthropy news coverage, and surveys and interviews of leaders and staff in philanthropy—indicates that grantmaking to AAPIs remains a relatively low priority, and that AAPIs continue to face barriers when it comes to serving in leadership roles

Brain transplantation of genetically corrected Sanfilippo type B neural stem cells induces partial cross-correction of the disease

Sanfilippo syndrome type B (mucopolysaccharidosis type IIIB) is a recessive genetic disorder that severely affects the brain due to a deficiency in the enzyme α

Enzyme Replacement Therapy for Mucopolysaccharidosis IIID using Recombinant Human α-N-Acetylglucosamine-6-Sulfatase in Neonatal Mice

There is currently no cure or effective treatment available for mucopolysaccharidosis type IIID (MPS IIID, Sanfilippo syndrome type D), a lysosomal storage disorder (LSD) caused by the deficiency of α-N-acetylglucosamine-6-sulfatase (GNS). The clinical symptoms of MPS IIID, like other subtypes of Sanfilippo syndrome, are largely localized to the central nervous system (CNS), and any treatments aiming to ameliorate or reverse the catastrophic and fatal neurologic decline caused by this disease need to be delivered across the blood–brain barrier. Here, we report a proof-of-concept enzyme replacement therapy (ERT) for MPS IIID using recombinant human α-N-acetylglucosamine-6-sulfatase (rhGNS) via intracerebroventricular (ICV) delivery in a neonatal MPS IIID mouse model. We overexpressed and purified rhGNS from CHO cells with a specific activity of 3.9 × 10⁴ units/mg protein and a maximal enzymatic activity at lysosomal pH (pH 5.6), which was stable for over one month at 4 °C in artificial cerebrospinal fluid (CSF). We demonstrated that rhGNS was taken up by MPS IIID patient fibroblasts via the mannose 6-phosphate (M6P) receptor and reduced intracellular glycosaminoglycans to normal levels. The delivery of 5 μg of rhGNS into the lateral cerebral ventricle of neonatal MPS IIID mice resulted in normalization of the enzymatic activity in brain tissues; rhGNS was found to be enriched in lysosomes in MPS IIID-treated mice relative to the control. Furthermore, a single dose of rhGNS was able to reduce the accumulated heparan sulfate and β-hexosaminidase. Our results demonstrate that rhGNS delivered into CSF is a potential therapeutic option for MPS IIID that is worthy of further development