DataSheet_2_sc-ImmuCC: hierarchical annotation for immune cell types in single-cell RNA-seq.xlsx

Accurately identifying immune cell types in single-cell RNA-sequencing (scRNA-Seq) data is critical to uncovering immune responses in health or disease conditions. However, the high heterogeneity and sparsity of scRNA-Seq data, as well as the similarity in gene expression among immune cell types, poses a great challenge for accurate identification of immune cell types in scRNA-Seq data. Here, we developed a tool named sc-ImmuCC for hierarchical annotation of immune cell types from scRNA-Seq data, based on the optimized gene sets and ssGSEA algorithm. sc-ImmuCC simulates the natural differentiation of immune cells, and the hierarchical annotation includes three layers, which can annotate nine major immune cell types and 29 cell subtypes. The test results showed its stable performance and strong consistency among different tissue datasets with average accuracy of 71-90%. In addition, the optimized gene sets and hierarchical annotation strategy could be applied to other methods to improve their annotation accuracy and the spectrum of annotated cell types and subtypes. We also applied sc-ImmuCC to a dataset composed of COVID-19, influenza, and healthy donors, and found that the proportion of monocytes in patients with COVID-19 and influenza was significantly higher than that in healthy people. The easy-to-use sc-ImmuCC tool provides a good way to comprehensively annotate immune cell types from scRNA-Seq data, and will also help study the immune mechanism underlying physiological and pathological conditions.</p

DataSheet_1_sc-ImmuCC: hierarchical annotation for immune cell types in single-cell RNA-seq.docx

Accurately identifying immune cell types in single-cell RNA-sequencing (scRNA-Seq) data is critical to uncovering immune responses in health or disease conditions. However, the high heterogeneity and sparsity of scRNA-Seq data, as well as the similarity in gene expression among immune cell types, poses a great challenge for accurate identification of immune cell types in scRNA-Seq data. Here, we developed a tool named sc-ImmuCC for hierarchical annotation of immune cell types from scRNA-Seq data, based on the optimized gene sets and ssGSEA algorithm. sc-ImmuCC simulates the natural differentiation of immune cells, and the hierarchical annotation includes three layers, which can annotate nine major immune cell types and 29 cell subtypes. The test results showed its stable performance and strong consistency among different tissue datasets with average accuracy of 71-90%. In addition, the optimized gene sets and hierarchical annotation strategy could be applied to other methods to improve their annotation accuracy and the spectrum of annotated cell types and subtypes. We also applied sc-ImmuCC to a dataset composed of COVID-19, influenza, and healthy donors, and found that the proportion of monocytes in patients with COVID-19 and influenza was significantly higher than that in healthy people. The easy-to-use sc-ImmuCC tool provides a good way to comprehensively annotate immune cell types from scRNA-Seq data, and will also help study the immune mechanism underlying physiological and pathological conditions.</p

A Self-Assembled Copper-Selenocysteine Nanoparticle for Enhanced Chemodynamic Therapy via Oxidative Stress Amplification

Chemodynamic therapy (CDT) as a catalytic anticancer strategy utilizes transition metal ions to initiate the Fenton reaction to produce high levels of cytotoxic hydroxyl radicals(·OH) in situ. Nevertheless, current existing CDTs are normally restricted by the high levels of existing antioxidant molecules and/or enzymes, such as glutathione (GSH) and thioredoxin reductase (TrxR), in a tumor internal environment, which could suppress CDT via ·OH depletion. Herein, to enhance ·OH-induced cellular damage by CDT, a self-assembled copper-selenocysteine nanoparticles (Cu-SeC NPs) was fabricated through a one-pot process. In our design, once Cu-SeC NPs were endocytosed by tumor cells, Cu2+ was reduced to Cu+ by cellular GSH, promoting in situ Fenton-like reactions to trigger ·OH rapid production in cells as well as the depletion of GSH. Furthermore, the gradually released selenocysteine can inhibit TrxR activity to weaken the protection of antioxidant systems and provide a favorable microenvironment for CDT. As a result, both paths synergistically resulted in massive reactive oxygen species (ROS) accumulation and amplified oxidative stress in tumor sites for enhanced CDT. As a new intelligent anticancer nanoplatform, Cu-SeC NPs exhibit synergistic antitumor effects with negligible systemic toxicity. Thus, the proposed strategy provides a new avenue for further development of progressive therapeutic systems

Precise Distance Control and Functionality Adjustment of Frustrated Lewis Pairs in Metal–Organic Frameworks

We report the construction of frustrated Lewis pairs (FLPs) in a metal–organic framework (MOF), where both Lewis acid (LA) and Lewis base (LB) are fixed to the backbone. The anchoring of a tritopic organoboron linker as LA and a monotopic linker as LB to separate metal oxide clusters in a tetrahedron geometry allows for the precise control of distance between them. As the type of monotopic LB linker varies, pyridine, phenol, aniline, and benzyl alcohol, a series of 11 FLPs were constructed to give fixed distances of 7.1, 5.5, 5.4, and 4.8 Å, respectively, revealed by 11B–1H solid-state nuclear magnetic resonance spectroscopy. Keeping LA and LB apart by a fixed distance makes it possible to investigate the electrostatic effect by changing the functional groups in the monotopic LB linker, while the LA counterpart remains unaffected. This approach offers new chemical environments of the active site for FLP-induced catalysis

SPAK expression and co-expression with NKCC1 or KCC2 in hippocampal neurons.

<p>(a) SPAK co-expression with NeuN. (b) SPAK co-expression with NKCC1. (c) SPAK co-expression with KCC2. <i>In </i><i>vivo</i> shows them in mouse hippocampus neurons. <i>In </i><i>vitro</i> shows them in cultured hippocampal neurons (arrows indicate positive cells).</p

Interaction of SPAK with CCCs and [Cl^-]_i in cultured hippocampal neurons at various stages.

<p>(a) (b) The intensity of interaction between SPAK and NKCC1 or KCC2 increased markedly after oxygen deprivation, while SPAK over-expression strengthened the interactions. (c) (d) The [Cl^-]_i of hippocampus neurons depict the corresponding and interesting changes in differing conditions. NoI: non-infection group. NeI: negative infection group. SO: SPAK overexpression group. OD: oxygen-deprivation. NOD: non-oxygen-deprivation. ^#<i>P</i><0.05 versus non-infection group and negative infection group, * versus non-oxygen-deprivation group.</p

Alterations in expression of SPAK and CCCs in cultured hippocampal neurons after SPAK overexpression and/or oxygen deprivation.

<p>(a), (b) SPAK expression level increases after oxygen deprivation in various groups. The bands with molecular weights of 67 kDa and 95 kDa represent endogenous and exogenous SPAK, respectively. (c) (d) NKCC1 expression level increases after oxygen-deprivation in various groups. NKCC1 expression level does not change following SPAK overexpression in any condition. (d) (e) KCC2 expression declines after oxygen-deprivation in various groups. KCC2 expression levels do not change following SPAK overexpression in any condition. NoI: non-infection group. NeI: negative infection group. SO: SPAK overexpression group. OD: oxygen-deprivation. NOD: non-oxygen-deprivation. Values are mean ± SD, ^#<i>P</i><0.05 versus the non-oxygen-deprivation group.</p

Enantioselective Access to Chiral 2‑Substituted 2,3-Dihydrobenzo[1,4]dioxane Derivatives through Rh-Catalyzed Asymmetric Hydrogenation

Rh-catalyzed asymmetric hydrogenation of various benzo­[<i>b</i>]­[1,4]­dioxine derivatives was successfully developed to prepare chiral 2-substituted 2,3-dihydrobenzo­[1,4]­dioxane derivatives using ZhaoPhos and <i>N</i>-methylation of ZhaoPhos ligands with high yields and excellent enantioselectivities (up to 99% yield, >99% enantiomeric excess (ee), turnover number (TON) = 24 000). Moreover, this asymmetric hydrogenation methodology, as the key step with up to 10 000 TON, was successfully applied to develop highly efficient synthetic routes for the construction of some important biologically active molecules, such as MKC-242, WB4101, BSF-190555, and (<i>R</i>)-doxazosin·HCl

Details of measured amplicons and PCR primers.

<p><i>Abbreviations</i>: LINE-1: long interspersed nucleotide element-1; MTHFR: methylenetetrahydrofolate reductase.</p><p>¹10mer space tag is added at the 5’ primer end with the following sequence: 5’- aggaagagag+primer</p><p>²T7 promoter is added at the 5’ primer end with the following sequence: 5’- cagtaatacgactcactatagggagaaggct+primer</p><p>Details of measured amplicons and PCR primers.</p

Comparison of serum OCM nutrient levels among the control, LTG and VPA groups.

<p>A serum Hcy levels, B serum FA levels and C serum VitB12 levels. *P<0.05. <i>Abbreviations</i>: Hcy: homocysteine; FA: folate; VitB12: vitamin B12; LTG: lamotrigine; VPA: valproate.</p