Additional file 1: of A pivotal role of BEX1 in liver progenitor cell expansion in mice

Figure S1. Genetic ablation of Bex1 in mice. Genomic DNA was isolated, and genotyping of Bex1 performed using PCR. Primers as follows: Bex1–3′, TTCATTTCCCCATCTGAAAGGTCCG; Bex1–5′, TCCCACCTACTCACCCATCCTTCTGG; LTR-5′, AAATGGCGTTACTTAAGCTAGCTTGC. Product size for WT mice is 352 bp, and for Bex1−/− mice is 223 bp (PDF 47 kb

Correlation of TLR4, MD-2, and CXCR7 expression with clinicopathologic features in colorectal carcinoma.

<p>Correlation of TLR4, MD-2, and CXCR7 expression with clinicopathologic features in colorectal carcinoma.</p

LPS-TLR4-MD-2 induced CXCR7 expression alteration in colorectal carcinoma cell line.

<p>A, Reverse transcriptase (RT)-PCR analysis (TLR4 and MD-2) on RNA isolated from 8 human colorectal carcinoma cell lines. B, LPS induced time- and dose-dependent CXCR7 and CXCR4 protein expression alterations. SW480 and Colo 205 cell lines were incubated with LPS (500 ng/ml) in the presence or absence of PMB (500 µg/ml), representative flow cytometric analysis of CXCR7 expression alterations were showed. C, LPS exposure induced a significant CXCR7 expression increase in total RNA conten. D, Exposure of SW480 and Colo 205 cell lines to LPS (500 ng/ml) had no effect on CXCR4 expression.</p

The simple and multiple logistic regression model analyzing the predictors of colorectal carcinoma lymph node metastasis.

<p>*ORs and 95% CIs were calculated by unconditional logistic regression after adjusting for age, sex, tumor size and histologic grade.</p

Proliferation, apoptosis and migration of CXCR7-positive SW480 and Colo 205 cell lines incubated with LPS.

<p>A, Incubation with LPS, SW480 cell line pretreated with AMD3100 (10 µg/ml) proliferated significantly in response to CXCL12 (100 ng/ml; 48 h), Colo 205 cell line also proliferated significantly in response to CXCL12. B, CXCL12 activation of its receptor CXCR7 did not exert an antiapoptotic effect. C, Pretreatment with AMD3100, SW480 cell line migrated significantly more in response to CXCL12 after 24 h of incubation with LPS, Colo 205 cell line also migrated significantly in response to CXCL12.</p

Knockdown effect of MD-2 on exposure of TLR4 to LPS in SW480 and Colo 205 cell lines.

<p>A, SW480 and Colo 205 cell lines were transfected transiently with siRNA or negative control sequence(NC). SW480 and Colo 205 cell lines transfected with the MD-2 siRNA sequence exhibited a marked reduction in MD-2 mRNA and protein level compared with NC. B, After LPS treatment, flow cytometry and real-time quantitative-PCR were performed. Knockdown of MD-2 inhibited LPS-mediated CXCR7 expression.</p

Correlation of combined high expression of TLR4, MD-2, and CXCR7 with tumor size and metastasis.

<p>Correlation of combined high expression of TLR4, MD-2, and CXCR7 with tumor size and metastasis.</p

Representative examples of immunohistochemical staining of TLR4, MD-2, and CXCR7 in colorectal carcinoma tissues (original magnification 100×).

<p>Positive staining was observed as a dark brown color. Normal colorectal tissues showed negative immunohistochemical staining of TLR4 (A), MD-2 (B), and CXCR7 (C), and colorectal carcinoma tissues showed strong staining of TLR4 (D), MD-2 (E), and CXCR7 (F).</p

Additional file 1: of Distinct roles of Dlk1 isoforms in bi-potential differentiation of hepatic stem cells

Table S1. Primers used in PCR (DOCX 33 kb