Flow cytometric analysis of the binding affinities between 3 x 10⁵<i>C</i>. <i>parvum</i> oocysts and 300nM 56-FAM labeled aptamer pools.

<p>A control experiment was performed using the native DNA library instead of aptamer pools.</p

DNA sequences of clones isolated from the 1^st, 4^th and 8^th pools.

<p>Where F is the forward PCR primer (CTCCTCTGACTGTAACCACG) and cR is the reverse-complement of the reverse PCR primer (GCATAGGTAGTCCAGAAGCC).</p><p>DNA sequences of clones isolated from the 1^st, 4^th and 8^th pools.</p

Detection of <i>C</i>. <i>parvum</i> in fruit concentrates.

<p>(A) Square wave voltammograms of the selectivity experiments performed by incubating the R4–6 aptamer-based sensor with (<i>a</i>) buffer alone, (<i>b</i>) 300 <i>Cryptosporidium parvum</i> oocysts, and (<i>c</i>) 700 <i>C</i>. <i>parvum</i> oocysts, in pineapple and mango concentrates. (B) Plot of ΔI <i>vs</i>. the tested target. All measurements were repeated three times with separate electrodes (p < 0.005).</p

Selectivity and specificity of the aptasensor.

<p>(A) Square wave voltammograms of the selectivity experiments performed by incubating the R4–6 aptamer-based sensor with (<i>a</i>) buffer alone, (<i>b</i>) 700 <i>C</i>. <i>parvum</i> oocysts, and (<i>c</i>) 1,000 <i>G</i>. <i>duodenalis</i> cysts, and (<i>d</i>) 5.1 mg/mL HSA. (B) Plot of ΔI and (C) ΔE <i>vs</i>. the tested target.</p

Affinity analyses of aptamer clones by square wave voltammetry.

<p>(A) Square wave voltammograms of developed aptasensors based on 14 aptamer sequences (R1–4 → R8–6) obtained before (violet curve) and after binding of 3,000 <i>Cryptosporidium parvum</i> oocysts (pink curve), whereas a control experiment is performed using an aptasensor based on the ssDNA library. All measurements were carried out after incubating the developed aptasensors with the oocysts in DPBS for 1 h at 25°C. Square wave voltammograms were carried out in the range of-400 to 800 mV with a step potential of 4 mV, amplitude of 5 mV, and frequency of 10 Hz. Electrochemical measurements were performed in PBS (pH 7.4), containing 2.5 mM of K₄[Fe(CN)₆] and 2.5 mM of K₃[Fe(CN)₆]. (<b>B)</b> Plot of the aptamer sequence <i>vs</i>. the change in current intensity (ΔI) obtained after incubation of the developed respective aptasensors with 3,000 oocysts.</p

Schematic representation of an electrochemical detection protocol adopted for this study.

<p>A hybrid of a thiol-modified primer and aptamer was self-assembled onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Binding of the <i>Cryptosporidium parvum</i> oocyst to the immobilized aptamer causes an increase in the redox current, measured by square wave voltammetry.</p

Limit of detection of the aptasensor.

<p>(A) Square wave voltammograms obtained after incubating the R4–6 aptamer-based sensors with (<i>a</i>) 0, (<i>b</i>) 100, (<i>c</i>) 200, (<i>d</i>) 300, (<i>e</i>) 400, (<i>f</i>) 500, (<i>g</i>) 600, (<i>h</i>) 700, and (<i>i</i>) 800 <i>Cryptosporidium parvum</i> oocysts. (B) Calibration plot of the change in current intensity (ΔI) <i>vs</i>. number of oocysts. (C) Calibration plot of the change in potential (ΔE) <i>vs</i>. number of oocysts.</p