Huang CT, Muo CH, Sung FC, Chen PC. <b>Higher risk of chronic kidney disease in patients with concurrent hyperglycemic crisis during type 2 diabetes diagnosis_Supplementary Tables</b>

Using a propensity-score matched design, this cohort study aims to explore whether patients with newly diagnosed type 2 diabetes have higher risk of developing chronic kidney disease if the had concurrent hyperglycemic crisis at the time of their diabetes diagnosis.</p

Additional file 1 of Obesity indices and the risk of total and cardiovascular mortality among people with diabetes: a long-term follow-up study in Taiwan

Supplementary Material

Adverse Outcomes Associated with Pre-Existing and New-Onset Atrial Fibrillation in Patients with Acute Coronary Syndrome: A Retrospective Cohort Study

Full copyright for enhanced digital features is owned by the authors. Article full text The full text of this article can be found here. Provide enhanced digital features for this article If you are an author of this publication and would like to provide additional enhanced digital features for your article then please contact [email protected]. The journal offers a range of additional features designed to increase visibility and readership. All features will be thoroughly peer reviewed to ensure the content is of the highest scientific standard and all features are marked as ‘peer reviewed’ to ensure readers are aware that the content has been reviewed to the same level as the articles they are being presented alongside. Moreover, all sponsorship and disclosure information is included to provide complete transparency and adherence to good publication practices. This ensures that however the content is reached the reader has a full understanding of its origin. No fees are charged for hosting additional open access content. Other enhanced features include, but are not limited to: • Slide decks • Videos and animations • Audio abstracts • Audio slides </p

Additional file 1 of Prenatal lipopolysaccharide exposure induces anxiety-like behaviour in male mouse offspring and aberrant glial differentiation of embryonic neural stem cells

Additional file 1: Approved Animal Protocol MMH-A-S-106-52

Characteristics of patients with HIV infection and subjects in the comparison group.

Characteristics of patients with HIV infection and subjects in the comparison group.</p

Risk of stroke in patients with HIV infection according to calendar year of diagnosis.

Risk of stroke in patients with HIV infection according to calendar year of diagnosis.</p

Dependence of binding affinity on oligonucleotide sequence.

<p>A. Fluorescence titration in the standard buffer with 0.01 M NaCl: ◯, d(ATGTGGAAAATCTCTAGCAGT) (21+); ▴, d(ACTGCTAGAGATTTTCCACAT) (21-); ▪, duplex (21+/−). B. NaCl-induced reversal.</p

Risk of stroke in relation to HIV infection by age and sex.

Risk of stroke in relation to HIV infection by age and sex.</p

Risk of stroke in association with HIV infection according to time of follow-up.

Risk of stroke in association with HIV infection according to time of follow-up.</p

Binding of d(CCG)₈C to Arg-Trp-Arg-Trp-Lys-Leu-NH₂ as a function of [NaCl].

<p>A. Fluorescence titrations were performed as in Fig. 3, with the following [NaCl]: ▪, 0.01 M; ♦, 0.05 M; □, 0.075 M; ▴, 0.1 M. B. NaCl reversal: ▪, reversal of 0.01 M titration of Arg-Trp-Arg-Trp-Lys-Leu-NH₂ with d(CCG)₈C_; ◯, reversal of 0.01 titration of crotamine with d(CCG)₈C (data from Fig. 3B).</p