CRISPR Screen Raw Data

Raw data of the CRISPR screen results published in Nature Biomedical Engineering entitled "Identification of druggable regulators of cell secretion via a kinome-wide screen and high-throughput immunomagnetic cell sorting"</p

Protein Electrocatalysis for Direct Sensing of Circulating MicroRNAs

MicroRNAs (miRNAs) are potentially useful biomarkers for diagnosis, classification, and prognosis of many diseases, including cancer. Herein, we developed a protein-facilitated electrocatalytic quadroprobe sensor (Sens^PEQ) for detection of miRNA signature of chronic lymphocytic leukemia (CLL) in human serum. The developed signal-ON sensor provides a compatible combination of two DNA adaptor strands modified with four methylene blue molecules and electrocatalysis using glucose oxidase in order to enhance the overall signal gain. This enhanced sensitivity provided the response necessary to detect the low-abundant serum miRNAs without preamplification. The developed Sens^PEQ is exquisitely sensitive to subtle π-stack perturbations and capable of distinguishing single base mismatches in the target miRNA. Furthermore, the developed sensor was employed for profiling of three endogenous miRNAs characteristic to CLL, including hsa-miR-16-5p, hsa-miR-21-5p, and hsa-miR-150-5p in normal healthy serum, chronic lymphocytic leukemia Rai stage 1 (CLL-1), and stage 3 (CLL-3) sera, using a non-human cel-miR-39-3p as an internal standard. The sensor results were verified by conventional SYBR green-based quantitative reverse-transcription polymerase chain reaction (RT-qPCR) analysis

Flow cytometric analysis of the binding affinities between 3 x 10⁵<i>C</i>. <i>parvum</i> oocysts and 300nM 56-FAM labeled aptamer pools.

<p>A control experiment was performed using the native DNA library instead of aptamer pools.</p

Three-Mode Electrochemical Sensing of Ultralow MicroRNA Levels

MicroRNAs (miRNAs) are an emerging class of biomarkers that are frequently deregulated in cancer cells and have shown great promise for cancer classification and prognosis. In this work, we developed a three-mode electrochemical sensor for detection and quantitation of ultralow levels of miRNAs in a wide dynamic range of measured concentrations. The sensor facilitates three detection modalities based on hybridization (H-SENS), p19 protein binding (P-SENS), and protein displacement (D-SENS). The combined three-mode sensor (HPD-SENS) identifies as low as 5 aM or 90 molecules of miRNA per 30 μL of sample without PCR amplification, and can be operated within the dynamic range from 10 aM to 1 μM. The HPD sensor is made on a commercially available gold nanoparticles-modified electrode and is suitable for analyzing multiple miRNAs on a single electrode. This three-mode sensor exhibits high selectivity and specificity and was used for sequential analysis of miR-32 and miR-122 on one electrode. In addition, the H-SENS can recognize miRNAs with different A/U and G/C content and distinguish between a fully matched miRNA and a miRNA comprising either a terminal or a middle single base mutation. Furthermore, the H- and P-SENS were successfully employed for direct detection and profiling of three endogenous miRNAs, including hsa-miR-21, hsa-miR-32, and hsa-miR-122 in human serum, and the sensor results were validated by qPCR

Detection of <i>C</i>. <i>parvum</i> in fruit concentrates.

<p>(A) Square wave voltammograms of the selectivity experiments performed by incubating the R4–6 aptamer-based sensor with (<i>a</i>) buffer alone, (<i>b</i>) 300 <i>Cryptosporidium parvum</i> oocysts, and (<i>c</i>) 700 <i>C</i>. <i>parvum</i> oocysts, in pineapple and mango concentrates. (B) Plot of ΔI <i>vs</i>. the tested target. All measurements were repeated three times with separate electrodes (p < 0.005).</p

DNA sequences of clones isolated from the 1^st, 4^th and 8^th pools.

<p>Where F is the forward PCR primer (CTCCTCTGACTGTAACCACG) and cR is the reverse-complement of the reverse PCR primer (GCATAGGTAGTCCAGAAGCC).</p><p>DNA sequences of clones isolated from the 1^st, 4^th and 8^th pools.</p

Four-Way Junction Formation Promoting Ultrasensitive Electrochemical Detection of MicroRNA

MicroRNAs (miRNAs) represent a class of biomarkers that are frequently deregulated in cancer cells and have shown a great promise for cancer classification and prognosis. Here, we endeavored to develop a DNA four-way junction based electrochemical sensor (4J-SENS) for ultrasensitive miRNA analysis. The developed sensor can be operated within the dynamic range from 10 aM to 1 fM and detect as low as 2 aM of miR-122 (∼36 molecules per sample), without PCR amplification. Furthermore, the 4J-SENS was employed to profile endogenouse hsa-miR-122 in healthy human and chronic lymphocyitc leukemia (CLL) patient serum, and the results were validated by qPCR analysis

Electrochemical Sensing of Aptamer-Facilitated Virus Immunoshielding

Oncolytic viruses (OVs) are promising therapeutics that selectively replicate in and kill tumor cells. However, repetitive administration of OVs provokes the generation of neutralizing antibodies (nAbs) that can diminish their anticancer effects. In this work, we selected DNA aptamers against an oncolytic virus, vesicular stomatitis virus (VSV), to protect it from nAbs. A label-free electrochemical aptasensor was used to evaluate the degree of protection (DoP). The aptasensor was fabricated by self-assembling a hybrid of a thiolated ssDNA primer and a VSV-specific aptamer. Electrochemical impedance spectroscopy was employed to quantitate VSV in the range of 800–2200 PFU and a detection limit of 600 PFU. The aptasensor was also utilized for evaluating binding affinities between VSV and aptamer pools/clones. An electrochemical displacement assay was performed in the presence of nAbs and DoP values were calculated for several VSV-aptamer pools/clones. A parallel flow cytometric analysis confirmed the electrochemical results. Finally, four VSV-specific aptamer clones, ZMYK-20, ZMYK-22, ZMYK-23, and ZMYK-28, showed the highest protective properties with dissociation constants of 17, 8, 20, and 13 nM, respectively. Another four sequences, ZMYK-1, -21, -25, and -29, exhibited high affinities to VSV without protecting it from nAbs and can be further utilized in sandwich assays. Thus, ZMYK-22, -23, and -28 have the potential to allow efficient delivery of VSV through the bloodstream without compromising the patient’s immune system

Schematic representation of an electrochemical detection protocol adopted for this study.

<p>A hybrid of a thiol-modified primer and aptamer was self-assembled onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Binding of the <i>Cryptosporidium parvum</i> oocyst to the immobilized aptamer causes an increase in the redox current, measured by square wave voltammetry.</p