DNA sequences of clones isolated from the 1^st, 4^th and 8^th pools.

<p>Where F is the forward PCR primer (CTCCTCTGACTGTAACCACG) and cR is the reverse-complement of the reverse PCR primer (GCATAGGTAGTCCAGAAGCC).</p><p>DNA sequences of clones isolated from the 1^st, 4^th and 8^th pools.</p

Flow cytometric analysis of the binding affinities between 3 x 10⁵<i>C</i>. <i>parvum</i> oocysts and 300nM 56-FAM labeled aptamer pools.

<p>A control experiment was performed using the native DNA library instead of aptamer pools.</p

Electrochemical Sensing of Aptamer-Facilitated Virus Immunoshielding

Oncolytic viruses (OVs) are promising therapeutics that selectively replicate in and kill tumor cells. However, repetitive administration of OVs provokes the generation of neutralizing antibodies (nAbs) that can diminish their anticancer effects. In this work, we selected DNA aptamers against an oncolytic virus, vesicular stomatitis virus (VSV), to protect it from nAbs. A label-free electrochemical aptasensor was used to evaluate the degree of protection (DoP). The aptasensor was fabricated by self-assembling a hybrid of a thiolated ssDNA primer and a VSV-specific aptamer. Electrochemical impedance spectroscopy was employed to quantitate VSV in the range of 800–2200 PFU and a detection limit of 600 PFU. The aptasensor was also utilized for evaluating binding affinities between VSV and aptamer pools/clones. An electrochemical displacement assay was performed in the presence of nAbs and DoP values were calculated for several VSV-aptamer pools/clones. A parallel flow cytometric analysis confirmed the electrochemical results. Finally, four VSV-specific aptamer clones, ZMYK-20, ZMYK-22, ZMYK-23, and ZMYK-28, showed the highest protective properties with dissociation constants of 17, 8, 20, and 13 nM, respectively. Another four sequences, ZMYK-1, -21, -25, and -29, exhibited high affinities to VSV without protecting it from nAbs and can be further utilized in sandwich assays. Thus, ZMYK-22, -23, and -28 have the potential to allow efficient delivery of VSV through the bloodstream without compromising the patient’s immune system

Schematic representation of an electrochemical detection protocol adopted for this study.

<p>A hybrid of a thiol-modified primer and aptamer was self-assembled onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Binding of the <i>Cryptosporidium parvum</i> oocyst to the immobilized aptamer causes an increase in the redox current, measured by square wave voltammetry.</p

Anti-Fab Aptamers for Shielding Virus from Neutralizing Antibodies

Oncolytic viruses are promising therapeutics that can selectively replicate in and kill tumor cells. However, repetitive administration of viruses provokes the generation of neutralizing antibodies (nAbs) that can diminish their anticancer effect. In this work, we selected DNA aptamers against the antigen binding fragment (Fab) of antivesicular stomatitis virus polyclonal antibodies to shield the virus from nAbs and enhance its in vivo survival. For the first time, we used flow cytometry and electrochemical immunosensing to identify aptamers targeting the Fab region of antibodies. We evaluated the aptamers in a cell-based infection assay and found that several aptamer clones provide more than 50% shielding of VSV from nAbs and thus have the potential to enhance the delivery of VSV without compromising the patient’s immune system. In addition, we developed a bifunctional label-free electrochemical immunosensor for the quantitation of aptamer-mediated degree of shielding and the amount of vesicular stomatitis virus (VSV) particles. Electrochemical impedance spectroscopy was employed to interrogate the level of VSV in a linear range from 5 × 10⁴ to 5 × 10⁶ PFU mL^–1 with a detection limit of 10⁴ PFU mL^–1

Selectivity and specificity of the aptasensor.

<p>(A) Square wave voltammograms of the selectivity experiments performed by incubating the R4–6 aptamer-based sensor with (<i>a</i>) buffer alone, (<i>b</i>) 700 <i>C</i>. <i>parvum</i> oocysts, and (<i>c</i>) 1,000 <i>G</i>. <i>duodenalis</i> cysts, and (<i>d</i>) 5.1 mg/mL HSA. (B) Plot of ΔI and (C) ΔE <i>vs</i>. the tested target.</p

Affinity analyses of aptamer clones by square wave voltammetry.

<p>(A) Square wave voltammograms of developed aptasensors based on 14 aptamer sequences (R1–4 → R8–6) obtained before (violet curve) and after binding of 3,000 <i>Cryptosporidium parvum</i> oocysts (pink curve), whereas a control experiment is performed using an aptasensor based on the ssDNA library. All measurements were carried out after incubating the developed aptasensors with the oocysts in DPBS for 1 h at 25°C. Square wave voltammograms were carried out in the range of-400 to 800 mV with a step potential of 4 mV, amplitude of 5 mV, and frequency of 10 Hz. Electrochemical measurements were performed in PBS (pH 7.4), containing 2.5 mM of K₄[Fe(CN)₆] and 2.5 mM of K₃[Fe(CN)₆]. (<b>B)</b> Plot of the aptamer sequence <i>vs</i>. the change in current intensity (ΔI) obtained after incubation of the developed respective aptasensors with 3,000 oocysts.</p

Limit of detection of the aptasensor.

<p>(A) Square wave voltammograms obtained after incubating the R4–6 aptamer-based sensors with (<i>a</i>) 0, (<i>b</i>) 100, (<i>c</i>) 200, (<i>d</i>) 300, (<i>e</i>) 400, (<i>f</i>) 500, (<i>g</i>) 600, (<i>h</i>) 700, and (<i>i</i>) 800 <i>Cryptosporidium parvum</i> oocysts. (B) Calibration plot of the change in current intensity (ΔI) <i>vs</i>. number of oocysts. (C) Calibration plot of the change in potential (ΔE) <i>vs</i>. number of oocysts.</p

Electrochemical Differentiation of Epitope-Specific Aptamers

DNA aptamers are promising immunoshielding agents that could protect oncolytic viruses (OVs) from neutralizing antibodies (nAbs) and increase the efficiency of cancer treatment. In the present Article, we introduce a novel technology for electrochemical differentiation of epitope-specific aptamers (eDEA) without selecting aptamers against individual antigenic determinants. For this purpose, we selected DNA aptamers that can bind noncovalently to an intact oncolytic virus, vaccinia virus (VACV), which can selectively replicate in and kill only tumor cells. The aptamers were integrated as a recognition element into a multifunctional electrochemical aptasensor. The developed aptasensor was used for the linear quantification of the virus in the range of 500–3000 virus particles with a detection limit of 330 virions. Also, the aptasensor was employed to compare the binding affinities of aptamers to VACV and to estimate the degree of protection of VACV using the anti-L1R neutralizing antibody in a displacement assay fashion. Three anti-VACV aptamer clones, vac2, vac4, and vac6, showed the best immunoprotection results and can be applied for enhanced delivery of VACV. Another two sequences, vac5 and vac46, exhibited high affinities to VACV without shielding it from nAb and can be further utilized in sandwich bioassays

Detection of <i>C</i>. <i>parvum</i> in fruit concentrates.

<p>(A) Square wave voltammograms of the selectivity experiments performed by incubating the R4–6 aptamer-based sensor with (<i>a</i>) buffer alone, (<i>b</i>) 300 <i>Cryptosporidium parvum</i> oocysts, and (<i>c</i>) 700 <i>C</i>. <i>parvum</i> oocysts, in pineapple and mango concentrates. (B) Plot of ΔI <i>vs</i>. the tested target. All measurements were repeated three times with separate electrodes (p < 0.005).</p