Charge-Pairing Mechanism of Phosphorylation Effect upon Amyloid Fibrillation of Human Tau Core Peptide

Phosphorylation of a fibrillogenic protein, human tau, is believed to play crucial roles in the pathogenesis of Alzheimer’s disease. For elucidating molecular mechanisms of the phosphorylation effect on tau fibrillation, we synthesized a peptide, VQIVY310K (PHF6) and its phosphorylated derivative (PHF6pY). PHF6 is a partial peptide surrounding a plausible in vivo phosphorylation site Tyr310 and forms amyloid-type fibrils similar to those generated by full-length tau. Fibrillation of PHF6 and PHF6pY were studied by spectroscopic and microscopic methods, and the critical concentration of the fibrillation was determined for comparing the fibril stability. The results showed that the phosphorylation strongly influenced the fibrillation propensity of PHF6 by changing its dependency on pH and ionic strength. On the basis of the observations, we suggested that charged sites on the phosphate group and its electrostatic pairing with the neighboring charged residues were physical origins of the phosphorylation effect. To verify this charge-pairing mechanism, we conducted experiments using a series of PHF6 derivatives with non-native charge distributions. The electrostatic interaction in an intermolecular mode was also demonstrated by the system composed of two different peptide species, which found that fibrillation of nonphosphorylated PHF6 was drastically enhanced when a trace amount of phosphorylated PHF6 molecules coexisted. A simulation analysis utilizing crystal coordinates of the PHF6 fibril was also performed for interpreting the experimental results in a molecular level. The present study using the model peptide system gave us a microscopically insightful view on the roles of tau phosphorylation in amyloid-related diseases

Acid/Azole Complexes as Highly Effective Promoters in the Synthesis of DNA and RNA Oligomers via the Phosphoramidite Method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3‘-(allyl N,N-diisopropylphosphoramidite)s or 3‘-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3‘-O-(tert-butyldimethylsilyl)ribonucleoside 2‘-(N,N-diisopropylphosphoramidite)s or 2‘-O-(tert-butyldimethylsilyl)ribonucleoside 3‘-(N,N-diisopropylphosphoramidite)s used for the formation of 2‘−5‘ and 3‘−5‘ internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5‘-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, 5‘CGACACCCAATTCTGAAAAT3‘ (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3‘-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3‘-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as 5‘AGCUACGUGACUACUACUUU3‘ (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5‘-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2‘−5‘)adenylyl(2‘−5‘)adenosine (2−5A core)

Acid/Azole Complexes as Highly Effective Promoters in the Synthesis of DNA and RNA Oligomers via the Phosphoramidite Method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3‘-(allyl N,N-diisopropylphosphoramidite)s or 3‘-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3‘-O-(tert-butyldimethylsilyl)ribonucleoside 2‘-(N,N-diisopropylphosphoramidite)s or 2‘-O-(tert-butyldimethylsilyl)ribonucleoside 3‘-(N,N-diisopropylphosphoramidite)s used for the formation of 2‘−5‘ and 3‘−5‘ internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5‘-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, 5‘CGACACCCAATTCTGAAAAT3‘ (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3‘-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3‘-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as 5‘AGCUACGUGACUACUACUUU3‘ (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5‘-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2‘−5‘)adenylyl(2‘−5‘)adenosine (2−5A core)

Acid/Azole Complexes as Highly Effective Promoters in the Synthesis of DNA and RNA Oligomers via the Phosphoramidite Method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3‘-(allyl N,N-diisopropylphosphoramidite)s or 3‘-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3‘-O-(tert-butyldimethylsilyl)ribonucleoside 2‘-(N,N-diisopropylphosphoramidite)s or 2‘-O-(tert-butyldimethylsilyl)ribonucleoside 3‘-(N,N-diisopropylphosphoramidite)s used for the formation of 2‘−5‘ and 3‘−5‘ internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5‘-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, 5‘CGACACCCAATTCTGAAAAT3‘ (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3‘-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3‘-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as 5‘AGCUACGUGACUACUACUUU3‘ (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5‘-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2‘−5‘)adenylyl(2‘−5‘)adenosine (2−5A core)

Structural Evaluation of Tandem Hairpin Pyrrole–Imidazole Polyamides Recognizing Human Telomeres

A polyamide containing <i>N</i>-methylpyrrole (Py) and <i>N</i>-methylimidazole (Im), designated PIPA, binds with high affinity and specificity to specific nucleotide sequences in the minor groove of double-helical DNA. Based on a recent report of the synthesis of PIPA for telomere visualization, the present paper focused on the size of the connecting part (hinge region) of two PIPA segments of the tandem hairpin PIPA, Dab­(Im-Im-Py)-Py-Py-Py-Im-[Hinge]-Dab­(Im-Im-Py)-Py-Py-Py-Im-βAla-NH­(CH₂)₃N­(CH₃)-(CH₂)₃NH-[Dye]. The present paper also describes the characterization of binding by measuring the thermal melting temperature and surface plasmon resonance and by specific staining of telomeres (TTAGGG)­n in human cells. Microheterogeneity was also investigated by high-resolution mass spectrometry. We found that the optimal compound as the hinge segment for telomere staining was [-NH­(C₂H₄O)₂(C₂H₄)­CO-] with tetramethylrhodamine as the fluorescent dye