Article thumbnail

Study of Histopathological and Molecular Changes of Rat Kidney under Simulated Weightlessness and Resistance Training Protective Effect

By Ye Ding, Jun Zou, Zhili Li, Jijing Tian, Saed Abdelalim, Fang Du, Ruiping She, Desheng Wang, Cheng Tan, Huijuan Wang, Wenjuan Chen, Dongqiang Lv and Lingling Chang

Abstract

To explore the effects of long-term weightlessness on the renal tissue, we used the two months tail suspension model to simulate microgravity and investigated the simulated microgravity on the renal morphological damages and related molecular mechanisms. The microscopic examination of tissue structure and ultrastructure was carried out for histopathological changes of renal tissue morphology. The immunohistochemistry, real-time PCR and Western blot were performed to explore the molecular mechanisms associated the observations. Hematoxylin and eosin (HE) staining showed severe pathological kidney lesions including glomerular atrophy, degeneration and necrosis of renal tubular epithelial cells in two months tail-suspended rats. Ultrastructural studies of the renal tubular epithelial cells demonstrated that basal laminas of renal tubules were rough and incrassate with mitochondria swelling and vacuolation. Cell apoptosis in kidney monitored by the expression of Bax/Bcl-2 and caspase-3 accompanied these pathological damages caused by long-term microgravity. Analysis of the HSP70 protein expression illustrated that overexpression of HSP70 might play a crucial role in inducing those pathological damages. Glucose regulated protein 78 (GRP78), one of the endoplasmic reticulum (ER) chaperones, was up-regulated significantly in the kidney of tail suspension rat, which implied that ER-stress was associated with apoptosis. Furthermore, CHOP and caspase-12 pathways were activated in ER-stress induced apoptosis. Resistance training not only reduced kidney cell apoptosis and expression of HSP70 protein, it also can attenuate the kidney impairment imposed by weightlessness. The appropriate optimization might be needed for the long term application for space exploration

Topics: Research Article
Publisher: Public Library of Science
OAI identifier: oai:pubmedcentral.nih.gov:3100312
Provided by: PubMed Central

To submit an update or takedown request for this paper, please submit an Update/Correction/Removal Request.

Suggested articles

Citations

  1. (1986). [Water-salt homeostasis and space flight].
  2. (1988). A model for quantitative strength training of hindlimb muscles of the rat.
  3. (2005). A potential cause for kidney stone formation during space flights: enhanced growth of nanobacteria in microgravity.
  4. (2002). A rat resistance exercise regimen attenuates losses of musculoskeletal mass during hindlimb suspension.
  5. (2006). Albumin induces endoplasmic reticulum stress and apoptosis in renal proximal tubular cells.
  6. (1998). Alteration of renal function of rats following spaceflight. Am J Physiol 275: R1058–1065. 3 5 .M i y a k eM ,Y a m a s a k iM ,W a k iH ,K a t a h i r aK
  7. (1979). Altered bone turnover during spaceflight.
  8. (2002). An endoplasmic reticulum stress-specific caspase cascade in apoptosis. Cytochrome c-independent activation of caspase-9 by caspase-12.
  9. (2008). Apoptosis induced by endoplasmic reticulum stress involved in diabetic kidney disease.
  10. (2004). Apoptotic proteins in the temporal cortex in schizophrenia: high Bax/Bcl-2 ratio without caspase-3 activation.
  11. (2000). Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloidbeta.
  12. (1997). Caspases: the executioners of apoptosis.
  13. (1998). Caspases: the proteases of the apoptotic pathway.
  14. (2008). Cell death and endoplasmic reticulum stress: disease relevance and therapeutic opportunities.
  15. (1998). Cellular apoptosis and proliferation in experimental renal fibrosis.
  16. (2009). Cellular responses to endoplasmic reticulum stress and apoptosis.
  17. (1998). CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum.
  18. (2003). Computerized image analysis of Sirius Red-stained renal allograft biopsies as a surrogate marker to predict long-term allograft function.
  19. (2002). Coupling endoplasmic reticulum stress to the cell death program: role of the ER chaperone GRP78.
  20. (1997). Effect of a 14-day hindlimb suspension on cytosolic Ca2+ concentration in rat portal vein myocytes.
  21. (1999). Effects of hindlimb suspension on cytosolic Ca2+ and [3H]ryanodine binding in cardiac myocytes.
  22. (2008). Effects of rabbit sacculus rotundus antimicrobial peptides on the intestinal mucosal immunity in chickens.
  23. (1995). Effects of resistance training and dietary protein intake on protein metabolism in older adults.
  24. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
  25. (1997). Endoplasmic reticulum chaperones GRP78 and calreticulin prevent oxidative stress, Ca2+ disturbances, and cell death in renal epithelial cells.
  26. (2007). Endoplasmic reticulum stress and oxidative stress: a vicious cycle or a double-edged sword?
  27. (2009). Endoplasmic reticulum stress in the kidney as a novel mediator of kidney injury.
  28. (2006). Endoplasmic reticulum stress-induced apoptosis: multiple pathways and activation of p53-up-regulated modulator of apoptosis (PUMA) and NOXA by p53.
  29. (2004). Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR.
  30. (2000). Heat shock protein 70 inhibits caspase-dependent and -independent apoptosis in Jurkat T cells.
  31. (2002). Hindlimb unloading rodent model: technical aspects.
  32. (1998). Hsp70 exerts its anti-apoptotic function downstream of caspase-3-like proteases.
  33. (2001). Humans in space.
  34. (2007). Intracellular and extracellular functions of heat shock proteins: repercussions in cancer therapy.
  35. (2005). Involvement of endoplasmic reticulum (ER) stress in podocyte injury induced by excessive protein accumulation.
  36. (2001). Measurements of nuclear size in collecting tubules of the kidney of rats during prolonged hypokinesia and ambulatory conditions.
  37. (1991). Mechanism of postflight decline in osmotic concentration of urine in cosmonauts.
  38. (1996). Musculoskeletal adaptations to weightlessness and development of effective countermeasures.
  39. (2005). Oxidative stress and apoptosis in fetal rat liver induced by maternal cholestasis. Protective effect of ursodeoxycholic acid.
  40. (1997). PCNA: structure, functions and interactions.
  41. (1996). Protein metabolism in rheumatoid arthritis and aging. Effects of muscle strength training and tumor necrosis factor alpha.
  42. (2008). Proteinuria and hyperglycemia induce endoplasmic reticulum stress.
  43. (2005). Renal function in space: the link between osteoporosis, hypercalciuria, and aquaporins.
  44. (2000). Renal responsiveness to aldosterone during exposure to simulated microgravity.
  45. (2000). Renal vasopressin receptor expression and function in rats following spaceflight.
  46. (1994). Resistance exercise and growth hormone as countermeasures for skeletal muscle atrophy in hindlimb-suspended rats.
  47. (1997). Resistance training in space.
  48. (2001). Resistance training to counteract the catabolism of a low-protein diet in patients with chronic renal insufficiency. A randomized, controlled trial.
  49. (1999). Reversal of weightlessness-induced musculoskeletal losses with androgens: quantification by MRI.
  50. (2006). Samali A
  51. (1986). Skeletal response to dietary calcium in a rat model simulating weightlessness.
  52. (1987). Skeletal response to simulated weightlessness: a comparison of suspension techniques.
  53. (1994). Testes size and testosterone levels in a model for weightlessness.
  54. (2011). TGAAGTTGCCATCAGCAAACA NM017059 60 97 Perez et al [54] 2 Bcl-2 F- TGGGATGCCTTTGTGGAACT R-TCTTCAGAGACTGCCAGGAGAAA U34964 60 73 Perez et al [54] 3 caspase-3 F- AATTCAAGGGACGGGTCATG R-
  55. (2002). The danger model: a renewed sense of self.