Location of Repository

Vaccine trials against canine leishmaniasis

By Connor Carson

Abstract

Zoonotic visceral leishmaniasis (ZVL) is a fatal disease caused by the sandfly-borne\ud intracellular protozoan parasite Leishmania infantum, and vaccine development in the\ud reservoir host (the domestic dog) is a current research priority. The aims of this study were\ud (1) to conduct safety and immunogenicity trials of two candidate vaccines in dogs, and (2)\ud to compare and demonstrate the utility of immunological and molecular tools for\ud measurement of vaccine efficacy in naturally exposed dogs.\ud DNA/ modified vaccinia virus Ankara (MVA) prime/boost canine vaccines expressing the\ud Leishmania proteins TRYP and LACK were safe, and elicited a type-1 cytokine response,\ud in vivo delayed-type hypersensitivity and IgG2 class responses, consistent with superior\ud protective immunogenicity of TRYP over LACK. However, inconsistent associations were\ud found between progressive disease in infected dogs and IgG class levels, prompting\ud caution in use of the latter as a proxy for protective immunogenicity. Specific serological\ud responses in vaccinated dogs did not cross-react with an unrelated diagnostic antigen\ud rK39, and responses to crude parasite antigen (CLA) were minimal, enabling serological\ud detection of infection incidence in vaccinated dogs. Particularly in early stage infection,\ud CLA ELISA was more sensitive than rK39 ELISA and an rK39-based rapid diagnostic\ud test, though rK39 serology was sensitive for diagnosis of symptomatic clinical cases.\ud A commercially available PCR kit incorporating a rapid oligochromatographic detection\ud step was tested for the first time in dogs, and proved highly sensitive for detection of ZVL\ud infection in bone marrow, comparable to existing nested PCR methods. Molecular\ud methods were investigated as proxy measures to replace labour-intensive xenodiagnosis\ud for detection of the infectiousness of dogs to biting sand flies. Conventional and real-time\ud PCR of tissues from naturally infected dogs were sensitive tests to identify infectiousness,\ud but showed low to moderate specificity. Recommendations are made to improve the\ud application of molecular methods as proxy measures of infectiousness and hence vaccine\ud efficacy

Topics: QL, RA
OAI identifier: oai:wrap.warwick.ac.uk:3637

Suggested articles

Preview

Citations

  1. (2005). IR2 GCGGGTAGTCCTGCCAAACACTCAGGTCTG Cupolillo et al.,1995; Parvizi et al.,

To submit an update or takedown request for this paper, please submit an Update/Correction/Removal Request.